Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1302 URS0000442977_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1302: Hsa-mir-1302 is a microRNA that has been found to target five genes and has differential expression linked to Alzheimer's disease (AD) [PMC9312389]. It is a member of the hsa-mir-1302 family, which consists of multiple similar members [PMC2996404]. The function of hsa-mir-1302 is still unknown [PMC2996404]. The hsa-mir-1302 family has been found to be formed by segmental duplication events, and the expansion of this family may be contributed by both segmental duplication events and MER53 transposition [PMC2996404]. The targets of hsa-mir-1302 have been annotated using WebGestalt to determine the functions and pathways involved [PMC2996404]. The members of the hsa-mir-1302 family are not located in regions of segmental duplications, suggesting that they may be products of MER53 transposition events alone [PMC2996404]. Hsa-mir-1302 is a placental-specific gene family, as it is only found in placental mammals and not in opossum and platypus [PMC2996404]. Hsa-mir-1302 has been identified as a potential binding partner to the mutant GCK 3'-UTR, which may impact its stability and lead to lower expression levels [PMC4827006]. It has also been associated with infertility along with other miRNAs such as hsa-let-7b, hsa-mir-122, and hsa-mir-133b [PMC8995652]. The members of the hsa-miR-548 family are not mentioned in the provided references. Hsa-mir-1302 can derive from 11 potential pre-miRNAs [PMC7067867].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGGACAUACUUAUGCUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1302
  2. Equus caballus (horse) eca-miR-1302d
  3. Pan troglodytes ptr-miR-1302
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-1302
Publications