Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (rice) osa-miR396e-5p URS0000440877_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR396e-5p: Osa-mir396e-5p is a miRNA that has been investigated for its role in rice immunity [PMC7037501]. It has been shown that the expression trends of osa-mir396e-5p in qRT-PCR experiments were consistent with the data from small RNA-seq, indicating its potential importance in rice immunity [PMC7037501]. Osa-mir396e-5p is also a member of the conserved miRNA family involved in the carbohydrate network [PMC7589925]. In a study on DXWR, osa-mir396e-5p was identified as one of the most abundantly expressed conserved miRNAs [PMC9960954]. Interestingly, osa-mir396e-5p was found to be up-regulated by RSV infection but not expressed in mock samples, suggesting its potential role in RSV infection [PMC5023111]. Osa-mir396e-5p has been found to have 21 target genes, including SAC9 protein and growth-regulating factor, indicating its potential multifunctionality in rice [PMC5023111]. Furthermore, osa-mir396e-5p was consistently up-regulated by RSV at all stages of infection [PMC5023111]. Given these findings, further research is needed to fully characterize the role of osa-mir396e-5p associated with RSV infection and its potential implications for rice immunity and carbohydrate metabolism.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCACAGGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Aegilops tauschii ata-miR396d-5p
  2. Ananas comosus microRNA 396e
  3. Brachypodium distachyon (stiff brome) bdi-miR396b-5p
  4. Lolium arundinaceum far-miR396
  5. Oryza sativa Japonica Group microRNA osa-miR396e-5p
Publications