Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aegilops tauschii ata-miR396d-5p URS0000440877_37682

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ata-miR396a-5p: Ata-mir396a-5p is a microRNA (miRNA) that has been identified in several plant species, including E. curvula, maize, and Arabidopsis. It has been shown to be involved in various biological processes and regulatory pathways. In E. curvula, qRT-PCR analysis revealed the presence of ata-mir396a-5p, along with other miRNAs such as ata-miR2275a-3p and gma-miR156d [PMC6852985]. In another study, ata-mir396a-5p was found to be associated with target genes involved in embryogenic callus formation [PMC5003897]. Furthermore, the expression of ata-mir396a-5p was found to be down-regulated in XZ29, while osa-miR319a-3p was up-regulated [PMC6069884]. Degradome analysis also identified ata-mir396a-5p as one of the miRNAs associated with target genes involved in various biological processes [PMC6069884]. Additionally, ata-mir396a-5p was found to be relatively abundant at 7 DAA (days after anthesis) and its target genes were associated with grain size regulation [PMC7045451]. Furthermore, ata-mir396a-5p was found to be relatively more abundant during early stages of grain development compared to later stages [PMC7045451]. Overall, these findings highlight the importance of ata-mir396a-5p in plant development and its potential role in regulating various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCACAGGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Ananas comosus microRNA 396e
  2. Brachypodium distachyon (stiff brome) bdi-miR396b-5p
  3. Lolium arundinaceum far-miR396
  4. Oryza sativa Japonica Group microRNA osa-miR396e-5p
  5. Oryza sativa (rice) osa-miR396e-5p
Publications