Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FTX transcript, XIST regulator URS000043C800_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FTX: The expression levels of FTX were found to be upregulated in thyroid cancer tissues and cells, and high FTX expression was associated with lymph node metastasis and clinical stage [PMC8323005]. FTX has been shown to have biological effects on myocardial cells and is being investigated for its potential effects on cardiac diseases [PMC9814437]. FTX expression has also been evaluated for its prognostic value in glioma patient survival [PMC7685110]. Loss of FTX activity may lead to iron-derived, free radical-based oxidant events that can be detrimental to mitochondrial function and affect the whole cell [PMC4496698]. Knockdown of UBE2C downregulated the expression of lncRNA FTX, miR-4429, UBE2C, as well as the phosphorylation levels of AKT, CDK1, and CDK6 [PMC9350997]. Overexpression of FTX has been shown to promote migration and invasion in osteosarcoma cells through the ECM mechanism [PMC9055732]. The ceRNA regulatory networks of FTX have been predicted using bioinformatics programs for potential molecular mechanisms in lung cancer [PMC7176842]. The downregulation of FTX expression has been observed during the conversion from NAFLD to HCC [PMC7315496]. The PPARĪ³ pathway is targeted by lncRNA FTX in promoting HCC progression and glycolysis [PMC6017247]. JPX, another positive regulator similar to XIST and FTX, has an oncogenic role in gastric cancer through a ceRNA mechanism involving miR-197 and CXCR6 regulation [PMC8775829].\

Targeting miRNAs 8 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAGCACACUGCGGCGAUUCUGGAGAGGUUGUCCUUUUCUGGCAUCAGCGUUGCGGCUCGAGGCAAAGCUGGUCCUGUGCCUGCUGUCCAUUGCCGCUAAGGCCUGCUGCUGCCAUUCAGGCGUGUCUCUCUCUCUCUCUCUCUUUCAUGCCGCUCUCUCCACCCCAUCUUGGGACGGCCAGCUCUAAGAAUUCCUGCUACGACACUGAAUUCAACCAGGAGGUGAUGCCACACUCAAUCAGAAACUAUGCUACUGCUGAAGAGGUAUAUUGAGCCCUGCCUGGUUAACCUCCAGUGAGGUUAUUAGAGAAUUGGGAGAGGCUCAAAUCAGCAUCCUGCACCUAGUUAUCAAACCAUUGUGAAGUCUUGAUUCCUGGAUGGCCAGAAAACUUGUCAUUGGUCAAGAGCAACAUUAAGAUCUGCCUGUUACUCAUACUGAUGCUUCCUGCCCAGCAAGUUCAUCAGAGGGCGAGGAUGAAUUACGGUUGCCAUGAAUGUCCUUGUGAGGCAGUUGGGAAGCCUUGGCUGGAUUGUGAAGGAUAUUUGAAAAGUAUUUUAGAGUCCACCAGAUCAUCCAUGUGAGUGACCAUGCAGCAAAAGAAGGAGGGUCCUCUCAGUGAUUAAGGAUUAUGAAGUAUUAAUUCUUCCACUGAUAUCUCAAAAGGUGAUCUGGACAAAGGAACAGGUAUCUCAGGAUUCCUCCUUGGUCACUUUUCAGCAGCAGCCUGCUCUUCUUUUGCAAUCUCUUCAGGAUCUCUGUAGAAGUAGAGAUCAGGCAUGAACUCCCACGGGUGUUCACGGGAAAUGGUGCCACGCAUGCGCAGAACUUCCCGAGCCAGCAUCCACCACAUCAAACCCACUGAGUGAGCUCCCUUGUUGUUGCAUGGGAUGGCAAUGUCCACGUAUCACAGAGGAGAAUCUGUGUUACACAGAGCAAUGUAGAGACGGGGUUUCACCGUGUUAGCCAGGAUGGUCUCGAUCUCCUGACCUCAUGAUCCACCCGCCUUGGCCUCCCAAAGUGCUGGGAUUACAGGCGUGAACCACCGCGCCCGGCCAGGAGAGUGUAUUUUCUACACAUAAGUUCAGGUCAUCUCCACACAGACCCAGUUUGCCUCCCUCUUUUCCGAUCUGAAUGCCUUUAAUUUCCUUCUCUUGCCUAACUGUACUGGCUAGAACAUCCCGAACUAGGUUGAAUGAGGUGCUGAGAGUGGGCAUAAUUGGCUUCUUUACCUCCGAAGAAAAUAUUUCAUGUUUUCUUCAUUGAUUAUGAUGUUAGUUGUGGGUAUUUCAUUUACUGCCUAUAUGGUAUAAAGAUACAUUCCUUCUAUGCCUAAUUGGUUGACAGCUUUUAUUAUAUCAAAUUCUAUAAAACUGUUUUAUUUUUAAAUCUAUUGAGAUGAUCAAAUGGCGGUGUCCCUCCUCCUUUAUAAGACUAUUUAAAACAUCCUUGCCUCAGAGGGACAAAUCCCAUUUGAACAUGGCAAGUAAUCCUCUUAAUAUAAAGUGGAAUUAGGUUUGACAGAAAUUACCAGUGAAGCACUAUGGGCAUAUAUUUGAUAGGAGAUUUUUAUUAUGGAUACAAUUUACUUGUUAUUGGUCUCUUCAGAUAUUCUUUCUCAUGACUGGAUUUGCGUACGUUGUAUGAGUACAAAUUUUUUCAUUUAUUCUACGCUGCUCUUUAUUAUAUGCUUCCUUCUGUAAAAUUUGGACUGUUUGUUCUUCCCAUUAUAUUAAUAGUUGCUUCAGGUGUAACAUAAGGUUAUUUUUUAAGUACUUUUCUGGUAUCACAAAUAUUGGUGUUUUGUGUUUCAUCUUUCAUUUGUCAAAAUAUUUUUUAACUUCCAUUUGGAUUUAAUGAUUCACCCAUUCAUUAUUCAAAAGCAUAUUGUUUAAUUUCUAUGUGUUUGUGAACAUUCUAAUGUUCAUUCUACUAAUAGUUCCUAGGUUCAUGCAAUGUGCUUAAAAAUGUGGUAUAAUUUCUGUAUUAUUAAAUGUAAAACUAGUCUUGAUUCGUAACAUAAGGCCUACGCAAAGAUCCAUCUUCUGCAGAGAAGAAUGUAGAUUGUGCCGCUGUUAGACGAAGUAUUCUGUAUACGUCAGUUUGCUUUAUUUGGCAUAAAGUGUAGUGUAAGCCAGAUGUAGUGUAAGUCAGAUCCAGAUGAUCUGCCCAUUGCUGAAACUUCAGUACUUAAGUCCCCUAUUAUUAUUGUAUGGCAAUCUAUCUGUCCACUCAGAAGUUAUUAUAUUUGUUUUAUAUGAUUGAGCACUUCUGUUUUGGGUAUAUAUGUAUUUACAAUUACUAUAACCUCUUGCUGAAUUAACCCCUUUUACCAUUAUGUAAUAAACUUAUUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications