Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus subtilis BEST7613 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1) secondary structure diagram

Bacillus subtilis BEST7613 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1) URS000043457D_1204343

Automated summary: This tRNA sequence is 93 nucleotides long and is found in Bacillus subtilis BEST7613. Annotated by 1 database (GtRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Bacillus subtilis BEST7613 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1) sequence is a product of tRNA-Ser-TGA-1-1 gene.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGAGGAAUACCCAAGUCUGGCUGAAGGGAUCGGUCUUGAAAACCGACAGGGGUGUCAAAGCCCGCGGGGGUUCGAAUCCCUCUUCCUCCGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 170 other species

    1. Alkalihalobacillus gibsonii tRNA-Ser
    2. Bacillaceae bacterium HSR45 tRNA-Ser
    3. Bacillus aerius tRNA-Ser
    4. Bacillus amyloliquefaciens CC178 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    5. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    6. Bacillus amyloliquefaciens EBL11 tRNA-Ser
    7. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Ser
    8. Bacillus amyloliquefaciens IT-45 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    9. Bacillus amyloliquefaciens KHG19 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    10. Bacillus amyloliquefaciens LFB112 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    11. Bacillus amyloliquefaciens LL3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    12. Bacillus amyloliquefaciens TA208 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    13. Bacillus amyloliquefaciens tRNA-Ser
    14. Bacillus amyloliquefaciens UASWS BA1 tRNA-Ser
    15. Bacillus amyloliquefaciens UMAF6614 tRNA-Ser
    16. Bacillus amyloliquefaciens UMAF6639 tRNA-Ser
    17. Bacillus amyloliquefaciens XH7 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    18. Bacillus amyloliquefaciens Y2 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    19. Bacillus atrophaeus 1942 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    20. Bacillus atrophaeus subsp. globigii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    21. Bacillus atrophaeus tRNA-Ser
    22. Bacillus capparidis tRNA-Ser
    23. Bacillus cereus tRNA-Ser
    24. Bacillus glycinifermentans tRNA-Ser
    25. Bacillus gobiensis tRNA-Ser
    26. Bacillus halotolerans tRNA-Ser
    27. Bacillus haynesii tRNA-Ser
    28. Bacillus inaquosorum tRNA-Ser
    29. Bacillus intestinalis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    30. Bacillus licheniformis CG-B52 tRNA-Ser
    31. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    32. Bacillus licheniformis LMG 17339 tRNA-Ser
    33. Bacillus licheniformis LMG 6934 tRNA-Ser
    34. Bacillus licheniformis LMG 7559 tRNA-Ser
    35. Bacillus licheniformis tRNA-Ser(tga)
    36. Bacillus licheniformis WX-02 tRNA-Ser
    37. Bacillus methanolicus MGA3 tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
    38. Bacillus methanolicus PB1 tRNA-Ser
    39. Bacillus mojavensis tRNA-Ser
    40. Alkalicoccobacillus murimartini tRNA-Ser
    41. Bacillus nakamurai tRNA-Ser
    42. Bacillus paralicheniformis ATCC 9945a tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    43. Bacillus paralicheniformis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    44. Bacillus siamensis tRNA-Ser
    45. Bacillus sonorensis L12 tRNA-Ser
    46. Bacillus sonorensis tRNA-Ser
    47. Bacillus sp. 1021 tRNA-Ser
    48. Bacillus sp. 1s-1 tRNA-Ser
    49. Bacillus sp. 2211 tRNA-Ser
    50. Bacillus sp. 275 tRNA-Ser
    51. Bacillus sp. 5B6 tRNA-Ser
    52. Bacillus sp. 7D3 tRNA-Ser
    53. Bacillus sp. 916 tRNA-Ser
    54. Bacillus sp. A053 tRNA-Ser
    55. Bacillus sp. AM1(2019) tRNA-Ser
    56. Bacillus sp. ANT_WA51 tRNA-Ser
    57. Bacillus sp. BH072 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    58. Bacillus sp. BT1B_CT2 tRNA-Ser
    59. Bacillus sp. CCNWLCWHY013 tRNA-Ser
    60. Bacillus sp. CMAA 1185 tRNA-Ser
    61. Bacillus sp. CPSM8 tRNA-Ser
    62. Bacillus sp. DM2 tRNA-Ser
    63. Bacillus sp. EGD-AK10 tRNA-Ser
    64. Bacillus sp. EKM213B tRNA-Ser
    65. Bacillus sp. EKM417B tRNA-Ser
    66. Bacillus sp. EKM420B tRNA-Ser
    67. Bacillus sp. FJAT-14266 tRNA-Ser
    68. Bacillus sp. FJAT-27445 tRNA-Ser
    69. Bacillus sp. FMQ74 tRNA-Ser
    70. Bacillus sp. FW1 tRNA-Ser
    71. Bacillus sp. Gen2 tRNA-Ser
    72. Bacillus sp. GZB tRNA-Ser
    73. Bacillus sp. H15-1 tRNA-Ser
    74. Bacillus sp. HNA3 tRNA-Ser
    75. Bacillus sp. IB182487 tRNA-Ser
    76. Bacillus sp. (in: Bacteria) tRNA-Ser
    77. Bacillus sp. ISL-26 tRNA-Ser
    78. Bacillus sp. ISL-32 tRNA-Ser
    79. Bacillus sp. J41TS8 tRNA-Ser
    80. Bacillus sp. J5TS4 tRNA-Ser
    81. Bacillus sp. JNUCC-22 tRNA-Ser
    82. Bacillus sp. JS tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    83. Bacillus sp. LJBS06 tRNA-Ser
    84. Bacillus sp. LJBS17 tRNA-Ser
    85. Bacillus sp. LJBV19 tRNA-Ser
    86. Bacillus sp. LK7 tRNA-Ser
    87. Bacillus sp. LM 4-2 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    88. Bacillus sp. LUNF1 tRNA-Ser
    89. Bacillus sp. LYLB4 tRNA-Ser
    90. Bacillus sp. Lzh-5 tRNA-Ser
    91. Bacillus sp. MBGLi79 tRNA-Ser
    92. Bacillus sp. MBGLi97 tRNA-Ser
    93. Bacillus sp. MD-5 tRNA-Ser
    94. Bacillus sp. MT tRNA-Ser
    95. Bacillus sp. NSP9.1 tRNA-Ser
    96. Bacillus sp. PAMC26543 tRNA-Ser
    97. Bacillus sp. PAMC28748 tRNA-Ser
    98. Bacillus sp. Pc3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    99. Bacillus sp. PW192 tRNA-Ser
    100. Bacillus sp. Rc4 tRNA-Ser
    101. Bacillus sp. RHF6 tRNA-Ser
    102. Bacillus sp. RHFS10 tRNA-Ser
    103. Bacillus sp. RHFS18 tRNA-Ser
    104. Bacillus sp. Ru63 tRNA-Ser
    105. Bacillus sp. SDLI1 tRNA-Ser
    106. Bacillus sp. SN1 tRNA-Ser
    107. Bacillus sp. SN32 tRNA-Ser
    108. Paenibacillus sp. PL91 tRNA-Ser
    109. Bacillus paralicheniformis tRNA-Ser
    110. Bacillus sp. TH008 tRNA-Ser
    111. Bacillus sp. WR11 tRNA-Ser
    112. Bacillus sp. X2(2017) tRNA-Ser
    113. Bacillus sp. Y1 tRNA-Ser
    114. Bacillus sp. YP1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    115. Bacillus sp. ZY-1-1 tRNA-Ser
    116. Bacillus subtilis BEST7003 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    117. Bacillus subtilis HJ5 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    118. Bacillus subtilis J22 tRNA-Ser
    119. Bacillus subtilis J24 tRNA-Ser
    120. Bacillus subtilis J27 tRNA-Ser
    121. Bacillus subtilis KCTC 1028 = ATCC 6051a tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    122. Bacillus subtilis MB73/2 tRNA-Ser
    123. Bacillus subtilis PY79 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    124. Bacillus subtilis QB928 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    125. Bacillus subtilis QH-1 tRNA-Ser
    126. Bacillus subtilis subsp. globigii tRNA-Ser
    127. Bacillus inaquosorum KCTC 13429 tRNA-Ser
    128. Bacillus subtilis subsp. natto BEST195 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    129. Bacillus subtilis subsp. natto tRNA-Ser
    130. Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 tRNA-Ser
    131. Bacillus subtilis subsp. spizizenii str. W23 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    132. Bacillus spizizenii tRNA-Ser(tga)
    133. Bacillus subtilis subsp. spizizenii TU-B-10 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    134. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    135. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 tRNA-Ser
    136. Bacillus subtilis subsp. subtilis str. 168 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    137. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    138. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    139. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    140. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    141. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    142. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    143. Bacillus subtilis subsp. subtilis str. SMY tRNA-Ser
    144. Bacillus subtilis subsp. subtilis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    145. Bacillus subtilis TO-A tRNA-Ser
    146. Bacillus subtilis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    147. Bacillus subtilis XF-1 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
    148. Bacillus swezeyi tRNA-Ser
    149. Bacillus tequilensis tRNA-Ser(tga)
    150. Bacillus vallismortis tRNA-Ser
    151. Bacillus velezensis AS43.3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    152. Bacillus velezensis CAU B946 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    153. Bacillus velezensis FZB42 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    154. Bacillus velezensis M27 tRNA-Ser
    155. Bacillus velezensis NAU-B3 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    156. Bacillus velezensis NJN-6 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    157. Bacillus velezensis SQR9 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    158. Bacillus velezensis TrigoCor1448 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    159. Bacillus velezensis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    160. Bacillus velezensis UCMB5033 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    161. Bacillus velezensis UCMB5036 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    162. Bacillus velezensis UCMB5113 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    163. Bacillus velezensis YAU B9601-Y2 tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-1-2)
    164. Mycobacteroides abscessus subsp. massiliense tRNA-Ser(tga)
    165. Bacillus subtilis A29 tRNA-Ser
    166. Pseudomonas sp. ISL-88 tRNA-Ser
    167. Robertmurraya crescens tRNA-Ser
    168. Salipaludibacillus keqinensis tRNA-Ser
    169. Bacillus velezensis A3 tRNA-Ser
    170. Streptococcus pneumoniae tRNA-Ser(tga)
    2D structure Publications New