Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR169r-3p URS0000430A64_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR169r-3p: Osa-mir169r-3p is a member of the osa-miR169 family and is a downregulated miRNA in response to chilling stress in both 9311 and DC90 rice varieties [PMC9002458]. It is also downregulated in the phyB mutant [PMC4448008]. In one study, osa-mir169r-3p showed the most significant decrease in expression among differentially expressed miRNAs (DEMs) [PMC7076996]. Another study found that osa-mir169r-3p targets the ABC transporter encoded by LOC_Os11g07600, leading to its accumulation at high levels [PMC9597502]. Additionally, osa-mir169r-3p is one of the miRNAs that target OsHDZIP13, along with other miRNA families such as osa-miR414, osa-miR1429-3p, and osa-miR164d [PMC9405480]. These findings suggest that osa-mir169r-3p may play a role in phyB-mediated processes and senescence-associated regulation. However, further research is needed to fully understand its specific functions and regulatory mechanisms.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAAGUCUCCUCGGCUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR169r-3p
Publications