Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-683 URS000042B1B3_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-miR-683: Mmu-mir-683 is a miRNA that has been found to interact with various circular RNAs (circRNAs) and participate in apoptosis-correlated pathways involved in the pathogenesis of ischemia-reperfusion (IR) injury [PMC6595412]. Oxygen-glucose deprivation/reoxygenation (OGD/R) has been shown to upregulate the expression of mmu-circRNA-015947, which interacts with mmu-mir-683 and other miRNAs, potentially regulating downstream gene expression [PMC5689704]. Bioinformatics analysis has revealed that mmu-circRNA-015947 can bind with mmu-mir-683 and other miRNAs, leading to the elevation of target gene expression [PMC7710414]. In the colon, mmu-mir-683 is potentially involved in regulating the expression of 200 upregulated genes [PMC3084815]. In rats with sciatic nerve injury (SNI), circRNA_2837 has been shown to sponge members of the miR-34 family, including mmu-mir-683, leading to autophagy induction and neuronal protection [PMC7326721]. Additionally, in HT22 cells subjected to hypoxia/reoxidation, upregulated mmu-circRNA-015947 interacts with mmu-mir-683 and other miRNAs associated with neural damage, potentially regulating target gene expression [PMC7326721]. These findings suggest that mmu-mir-683 plays a role in various cellular processes through its interactions with circRNAs and other miRNAs.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCUGUAAGCUGUGUCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications