Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-933 URS0000425000_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-933: Hsa-mir-933 has been identified as one of the 10 miRNAs that may play a role in ovarian cancer survival [PMC8148489]. However, further investigation is needed to determine the specific function of hsa-mir-933 in this context [PMC8148489]. Additionally, hsa-mir-933 has been suggested as a potential regulator of type II diabetes mellitus [PMC7526404]. These findings suggest that hsa-mir-933 could have a significant impact on both ovarian cancer and diabetes [PMC7526404].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCGCAGGGAGACCUCUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Macaca mulatta mml-miR-933
  2. Pan troglodytes ptr-miR-933
  3. Pongo pygmaeus ppy-miR-933
Publications