Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-193b URS0000423E7F_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUGGCCCACAAAGUCCCGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Alligator mississippiensis (American alligator) ami-miR-193b-3p
  2. Bos taurus Bta-Mir-193-P1a_3p (mature (co-guide))
  3. Canis lupus familiaris (dog) Cfa-Mir-193-P1a_3p (mature (guide))
  4. Capra hircus chi-miR-193b-3p
  5. Cavia porcellus cpo-miR-193b-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-193-P1a_3p (mature (guide))
  7. Chrysemys picta cpi-miR-193b-3p
  8. Columba livia cli-miR-193-3p
  9. Cricetulus griseus cgr-miR-193b-3p
  10. Dasypus novemcinctus dno-miR-193b-3p
  11. Daubentonia madagascariensis (aye-aye) dma-miR-193
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-193-P1a_3p (mature (guide))
  13. Equus caballus eca-miR-193b
  14. Gallus gallus (chicken) Gga-Mir-193-P1a_3p (mature (guide))
  15. Microcebus murinus mmr-miR-193
  16. Monodelphis domestica (gray short-tailed opossum) mdo-miR-193b-3p
  17. Mus musculus (house mouse) mmu-miR-193b-3p
  18. Ornithorhynchus anatinus (platypus) oan-miR-193-3p
  19. Oryctolagus cuniculus ocu-miR-193b-3p
  20. Otolemur garnettii oga-miR-193b
  21. Pteropus alecto (black flying fox) pal-miR-193b-3p
  22. Python bivittatus (Burmese python) Pbv-Mir-193-P1a_3p (mature (guide))
  23. Rattus norvegicus (Norway rat) Rno-Mir-193-P1a_3p (mature (guide))
  24. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P1a_3p (mature (guide))
  25. Taeniopygia guttata (zebra finch) tgu-miR-193a-3p
  26. Tupaia chinensis tch-miR-193b-3p