Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-193b-3p URS0000423E7F_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 24 papers. Mus musculus (house mouse) mmu-miR-193b-3p sequence is a product of miR-193b-3p, mmu-miR-193b-3p, miR-193, miR-193b, Mir193b, mmu-miR-193b genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610009O20Rik, 0610010C04Rik, 0610010I05Rik, 0610010M22Rik, 0610011A13Rik, 0610013I17Rik, 0610039A15Rik, 0610039C21Rik, 0710001O20Rik, 0710008K06Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACUGGCCCACAAAGUCCCGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Alligator mississippiensis (American alligator) ami-miR-193b-3p
    2. Bos taurus Bta-Mir-193-P1b_3p (mature (co-guide))
    3. Canis lupus familiaris Cfa-Mir-193-P1b_3p (mature (guide))
    4. Capra hircus chi-miR-193b-3p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-193b-3p
    6. Cervus elaphus (red deer) cel-miR-193b
    7. Chrysemys picta bellii Cpi-Mir-193-P1b_3p (mature (guide))
    8. Chrysemys picta cpi-miR-193b-3p
    9. Columba livia (rock pigeon) cli-miR-193-3p
    10. Cricetulus griseus cgr-miR-193b-3p
    11. Dasypus novemcinctus dno-miR-193b-3p
    12. Daubentonia madagascariensis dma-miR-193
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-193-P1b_3p (mature (guide))
    14. Equus caballus (horse) eca-miR-193b
    15. Gallus gallus (chicken) Gga-Mir-193-P1b_3p (mature (guide))
    16. Microcebus murinus (gray mouse lemur) mmr-miR-193
    17. Monodelphis domestica mdo-miR-193b-3p
    18. Ornithorhynchus anatinus oan-miR-193-3p
    19. Oryctolagus cuniculus ocu-miR-193b-3p
    20. Otolemur garnettii (small-eared galago) oga-miR-193b
    21. Pteropus alecto (black flying fox) pal-miR-193b-3p
    22. Rattus norvegicus Rno-Mir-193-P1b_3p (mature (guide))
    23. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P1b_3p (mature (guide))
    24. Taeniopygia guttata tgu-miR-193a-3p
    25. Tupaia chinensis (Chinese tree shrew) tch-miR-193b-3p