Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-193b-3p URS0000423E7F_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, TarBase, MirGeneDB, ENA, PirBase, LncBase, miRBase). Mus musculus (house mouse) mmu-miR-193b-3p sequence is a product of mmu-miR-193b, miR-193b-3p, Mir193b, mmu-miR-193b-3p, miR-193b, miR-193 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610009O20Rik, 0610010C04Rik, 0610010I05Rik, 0610010M22Rik, 0610011A13Rik, 0610013I17Rik, 0610039A15Rik, 0610039C21Rik, 0710001O20Rik, 0710008K06Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AACUGGCCCACAAAGUCCCGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Alligator mississippiensis ami-miR-193b-3p
    2. Bos taurus Bta-Mir-193-P1a_3p (mature (co-guide))
    3. Canis lupus familiaris (dog) Cfa-Mir-193-P1a_3p (mature (guide))
    4. Capra hircus (goat) chi-miR-193b-3p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-193b-3p
    6. Cervus elaphus (red deer) cel-miR-193b
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-193-P1a_3p (mature (guide))
    8. Chrysemys picta cpi-miR-193b-3p
    9. Columba livia (rock pigeon) cli-miR-193-3p
    10. Cricetulus griseus cgr-miR-193b-3p
    11. Dasypus novemcinctus dno-miR-193b-3p
    12. Daubentonia madagascariensis (aye-aye) dma-miR-193
    13. Echinops telfairi Ete-Mir-193-P1a_3p (mature (guide))
    14. Equus caballus eca-miR-193b
    15. Gallus gallus (chicken) Gga-Mir-193-P1a_3p (mature (guide))
    16. Microcebus murinus (gray mouse lemur) mmr-miR-193
    17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-193b-3p
    18. Ornithorhynchus anatinus oan-miR-193-3p
    19. Oryctolagus cuniculus (rabbit) ocu-miR-193b-3p
    20. Otolemur garnettii oga-miR-193b
    21. Pteropus alecto pal-miR-193b-3p
    22. Python bivittatus Pbv-Mir-193-P1a_3p (mature (guide))
    23. Rattus norvegicus (Norway rat) Rno-Mir-193-P1a_3p (mature (guide))
    24. Sarcophilus harrisii Sha-Mir-193-P1a_3p (mature (guide))
    25. Taeniopygia guttata (zebra finch) tgu-miR-193a-3p
    26. Tupaia chinensis (Chinese tree shrew) tch-miR-193b-3p
    Publications New