Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-450b URS0000422A99_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-450b: Bta-mir-450b is a miRNA that is differentially expressed during different stages of pregnancy in cows [PMC9445238]. It is one of several miRNAs that show time-dependent expression patterns, with overexpression at parturition [PMC9445238]. However, bta-mir-450b is low-expressed overall, ranking below 100 [PMC6940744]. The target genes of bta-mir-450b are currently unknown [PMC6940744]. It has been found to be specific to the tested group in a study comparing differentially expressed miRNAs between two groups [PMC6940744]. Bta-mir-450b has been shown to be consistently downregulated across different conditions, suggesting its potential role in impairing cell proliferation through the downregulation of oncogenes such as CAM2KN1 [PMC8060439]. In bulls, the expression level of bta-mir-450b is significantly higher compared to steers [PMC5813002]. It has also been chosen as one of the target miRNAs for validation in a study investigating miRNA expression patterns [PMC6691986]. In certain conditions, such as high cell density samples, upregulation of bta-mir-450b has been observed [PMC4617749]. References: [PMC9445238] [PMC6940744] [PMC8060439] [PMC5813002] [PMC6691986] [PM4617749]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUGCAAUAUGUUCCUGAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Dasypus novemcinctus Dno-Mir-450-P3_5p (mature (guide))
  2. Equus caballus eca-miR-450b-5p
  3. Gorilla gorilla gorilla ggo-miR-450b (MIR450B)
  4. Gorilla gorilla ggo-miR-450b
  5. Homo sapiens hsa-miR-450b-5p
  6. Macaca mulatta mml-miR-450b-5p
  7. Oryctolagus cuniculus ocu-miR-450b-5p
  8. Pongo pygmaeus ppy-miR-450b-5p
  9. Sus scrofa (pig) ssc-miR-450b-5p
Publications