Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-450b-5p URS0000422A99_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (ENA, MalaCards, miRBase, GeneCards, TarBase, RefSeq, LncBase). Described in 26 papers. Homo sapiens (human) hsa-miR-450b-5p sequence is a product of MIR450B, miR-450, miR-450b-5p, miR-450b, hsa-miR-450b, hsa-miR-450b-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 17-BETA-HSD11, 17-BETA-HSDXI, 182-FIP, 1A6/DRIM, 82-FIP, A1CF, AA, AASD-PPT, AASDHPPT, ABHD17B.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUUGCAAUAUGUUCCUGAAUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Bos taurus (cattle) bta-miR-450b
    2. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-450-P3_5p (mature (guide))
    3. Equus caballus eca-miR-450b-5p
    4. Gorilla gorilla (western gorilla) ggo-miR-450b
    5. Macaca mulatta mml-miR-450b-5p
    6. Oryctolagus cuniculus ocu-miR-450b-5p
    7. Pongo pygmaeus ppy-miR-450b-5p
    8. Sus scrofa ssc-miR-450b-5p