Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-9-5p URS00004208C5_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, TarBase, MirGeneDB, MalaCards, ENA, IntAct, GeneCards, LncBase, miRBase). Homo sapiens (human) hsa-miR-9-5p sequence is a product of miR-9-5p, MIR9-3, hsa-miR-9-5p, hsa-miR-9, MIR9-2, miR-9, MIR9-1 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 15E1.2, 182-FIP, 19A, 1A1-3B, 2'-PDE, 2H9, 3'HEXO, 3635, 39K2.

Interactions 41

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-9-5p interacts with:

Interaction id Participant Synonyms
EBI-20764578 intact:EBI-20750170 EBI-20750170 ENST00000425538.5 mrna_myocardin
EBI-20764633 intact:EBI-20765269 EBI-20765269 ENST00000255194.10 mrna_ap3b1
EBI-20765254 intact:EBI-20765277 EBI-20765277 ENST00000340828.6 mrna_ccng1
EBI-20765257 intact:EBI-20765587 EBI-20765587 ENST00000336314 mrna_larp1
EBI-20765260 intact:EBI-20765597 EBI-20765597 ENST00000367321.7 mrna_mthfd1l
EBI-20765263 intact:EBI-20765605 EBI-20765605 ENST00000394053 mrna_mthfd2
EBI-20765684 intact:EBI-20765605 EBI-20765605 ENST00000394053 mrna_mthfd2
EBI-20765266 intact:EBI-20765614 EBI-20765614 ENST00000373825 mrna_srpk1
EBI-20765898 intact:EBI-20765910 EBI-20765910 ENST00000306503 mrna_socs5
EBI-20798148 intact:EBI-20800396 EBI-20800396 ENST00000407236 mrna_ppara
EBI-20816916 intact:EBI-20800410 EBI-20800410 ENST00000261769 mrna_cdh1 human
EBI-20813302 intact:EBI-20800410 EBI-20800410 ENST00000261769 mrna_cdh1 human
EBI-20798165 intact:EBI-20800410 EBI-20800410 ENST00000261769 mrna_cdh1 human
EBI-20819073 intact:EBI-20819129 EBI-20819129 ENST00000260302 mrna_mmp13
URS00004208C5_9606-0 O43295 O43295
URS00004208C5_9606-12 O43295 O43295
URS00004208C5_9606-13 P05231 P05231
URS00004208C5_9606-1 P05231 P05231
URS00004208C5_9606-2 P17081 P17081
URS00004208C5_9606-14 P17081 P17081
URS00004208C5_9606-4 P19838 P19838
URS00004208C5_9606-3 P19838 P19838
URS00004208C5_9606-16 P19838 P19838
URS00004208C5_9606-15 P19838 P19838
EBI-25566765 P33469 7a EBI-25566551 N Nucleocapsid protein P33469 Q6TNF5 ncap_cvhoc
EBI-25566812 P33469 7a EBI-25566551 N Nucleocapsid protein P33469 Q6TNF5 ncap_cvhoc
EBI-25566780 P33469 7a EBI-25566551 N Nucleocapsid protein P33469 Q6TNF5 ncap_cvhoc
URS00004208C5_9606-17 Q07869 Q07869
URS00004208C5_9606-5 Q07869 Q07869
URS00004208C5_9606-18 Q15375 Q15375
URS00004208C5_9606-6 Q15375 Q15375
URS00004208C5_9606-11 Q3ZCW2 Q3ZCW2
URS00004208C5_9606-19 Q3ZCW2 Q3ZCW2
URS00004208C5_9606-20 Q8NE31 Q8NE31
URS00004208C5_9606-7 Q8NE31 Q8NE31
URS00004208C5_9606-21 Q8WWK9 Q8WWK9
URS00004208C5_9606-8 Q8WWK9 Q8WWK9
URS00004208C5_9606-9 Q92569 Q92569
URS00004208C5_9606-22 Q92569 Q92569
URS00004208C5_9606-10 Q9H3E2 Q9H3E2
URS00004208C5_9606-23 Q9H3E2 Q9H3E2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCUUUGGUUAUCUAGCUGUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 106 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-9a
    2. Aedes aegypti aae-miR-9a
    3. Alligator mississippiensis Ami-Mir-9-P1_5p (mature (guide))
    4. Anolis carolinensis Aca-Mir-9-P1_5p (mature (guide))
    5. Anopheles gambiae aga-miR-9a
    6. Apis mellifera (honey bee) ame-miR-9a-5p
    7. Ascaris suum (pig roundworm) asu-miR-9-5p
    8. Ateles geoffroyi age-miR-9
    9. Blattella germanica Bge-Mir-9-o13_5p (mature (guide))
    10. Bombyx mori bmo-miR-9a-5p
    11. Bos taurus Bta-Mir-9-P1_5p (mature (guide))
    12. Branchiostoma belcheri bbe-miR-9-5p
    13. Branchiostoma floridae Bfl-Mir-9-P6_5p (mature (guide))
    14. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-9
    15. Callorhinchus milii Cmi-Mir-9-P1_5p (mature (guide))
    16. Canis lupus familiaris (dog) cfa-miR-9
    17. Capitella teleta cte-miR-9-5p
    18. Capra hircus (goat) chi-miR-9-5p
    19. Cavia porcellus (domestic guinea pig) cpo-miR-9-5p
    20. Centruroides sculpturatus Csc-Mir-9-P26_5p (mature (guide))
    21. Chrysemys picta bellii (western painted turtle) Cpi-Mir-9-P1_5p (mature (guide))
    22. Chrysemys picta cpi-miR-9-5p
    23. Cochliomyia hominivorax mature cho-miR-9a-5p
    24. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-9a-5p
    25. Columba livia (rock pigeon) cli-miR-9-5p
    26. Crassostrea gigas (Pacific oyster) Cgi-Mir-9-P19_5p (mature (guide))
    27. Danio rerio dre-miR-9-5p
    28. Daphnia magna Dma-Mir-9-o15_5p (mature (guide))
    29. Daphnia pulex (common water flea) dpu-miR-9-5p
    30. Dasypus novemcinctus dno-miR-9-5p
    31. Dinoponera quadriceps dqu-miR-9-5p
    32. Drosophila ananassae dan-miR-9a
    33. Drosophila erecta der-miR-9a
    34. Drosophila grimshawi dgr-miR-9a
    35. Drosophila melanogaster (fruit fly) dme-miR-9a-5p
    36. Drosophila mojavensis dmo-miR-9a
    37. Drosophila persimilis dpe-miR-9a
    38. Drosophila pseudoobscura dps-miR-9a
    39. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294529_df_nrg
    40. Drosophila sechellia dse-miR-9a
    41. Drosophila simulans dsi-miR-9a
    42. Drosophila virilis dvi-miR-9a-5p
    43. Drosophila willistoni dwi-miR-9a
    44. Drosophila yakuba dya-miR-9a
    45. Echinops telfairi Ete-Mir-9-P1_5p (mature (guide))
    46. Eisenia fetida (common brandling worm) Efe-Mir-9-P21_5p (mature (guide))
    47. Eptatretus burgeri (inshore hagfish) Ebu-Mir-9-P6_5p (mature (guide))
    48. Equus caballus eca-miR-9a
    49. Eurosta solidaginis (goldenrod gall fly) miR-9
    50. Gadus morhua (Atlantic cod) gmo-miR-9-5p
    51. Gallus gallus (chicken) gga-miR-9-5p
    52. Gekko japonicus Gja-Mir-9-P1_5p (mature (guide))
    53. Gorilla gorilla ggo-miR-9
    54. Haemonchus contortus hco-miR-9
    55. Heligmosomoides polygyrus hpo-miR-9-5p
    56. Hyalella azteca miR-9
    57. Ictalurus punctatus ipu-miR-9
    58. Ixodes ricinus iri-miR-9a-5p
    59. Ixodes scapularis (black-legged tick) Isc-Mir-9_5p (mature (guide))
    60. Lagothrix lagotricha (brown woolly monkey) lla-miR-9
    61. Latimeria chalumnae Lch-Mir-9-P1_5p (mature (guide))
    62. Lepisosteus oculatus Loc-Mir-9-P1_5p (mature (guide))
    63. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-9-P23_5p (mature (guide))
    64. Lingula anatina Lan-Mir-9_5p (mature (guide))
    65. Locusta migratoria (migratory locust) lmi-miR-9a-5p
    66. Lottia gigantea lgi-miR-9-5p
    67. Macaca mulatta (Rhesus monkey) mml-miR-9-5p
    68. Macaca nemestrina (pig-tailed macaque) mne-miR-9
    69. Maylandia zebra (zebra mbuna) mze-miR-9
    70. Melibe leonina mle-miR-9-5p
    71. Microcaecilia unicolor Mun-Mir-9-P1_5p (mature (guide))
    72. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p
    73. Monopterus albus Mal-Mir-9-P1b_5p (mature (guide))
    74. Mus musculus (house mouse) mmu-miR-9-5p
    75. Nasonia giraulti ngi-miR-9a
    76. Nasonia longicornis nlo-miR-9a
    77. Nasonia vitripennis nvi-miR-9a
    78. Nautilus pompilius Npo-Mir-9_5p (mature (co-guide))
    79. Ornithorhynchus anatinus Oan-Mir-9-P1_5p (mature (guide))
    80. Oryctolagus cuniculus (rabbit) ocu-miR-9-5p
    81. Oryzias latipes ola-miR-9b-5p
    82. Pan troglodytes (chimpanzee) ptr-miR-9
    83. Paralichthys olivaceus (Japanese flounder) pol-miR-9b-5p
    84. Parasteatoda tepidariorum pte-miR-9-5p
    85. Patiria miniata pmi-miR-9-5p
    86. Polistes canadensis pca-miR-9-5p
    87. Pongo pygmaeus ppy-miR-9
    88. Pteropus alecto pal-miR-9-5p
    89. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
    90. Python bivittatus Pbv-Mir-9-P1_5p (mature (guide))
    91. Rattus norvegicus (Norway rat) rno-miR-9a-5p
    92. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
    93. Salmo salar ssa-miR-9a-5p
    94. Sarcophilus harrisii Sha-Mir-9-P1_5p (mature (guide))
    95. Scyliorhinus torazame Sto-Mir-9-P1_5p (mature (guide))
    96. Sphenodon punctatus (tuatara) Spt-Mir-9-P1_5p (mature (co-guide))
    97. Strongylocentrotus purpuratus Spu-Mir-9_5p (mature (guide))
    98. Sus scrofa (pig) ssc-miR-9-1
    99. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
    100. Takifugu rubripes fru-miR-9
    101. Tetraodon nigroviridis tni-miR-9
    102. Tor tambroides miR-9-5p
    103. Tribolium castaneum Tca-Mir-9-o6_5p (mature (guide))
    104. Triops cancriformis tcf-miR-9a-5p
    105. Tupaia chinensis (Chinese tree shrew) tch-miR-9-5p
    106. Xenopus laevis (African clawed frog) Xla-Mir-9-P1d_5p (mature (co-guide))
    107. Xenopus tropicalis (tropical clawed frog) xtr-miR-9a-5p
    Publications New