Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-9-5p URS00004208C5_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (TarBase, RefSeq, ENA, MirGeneDB, miRBase, IntAct, GeneCards, MalaCards, LncBase). Described in 123 papers. Homo sapiens (human) hsa-miR-9-5p sequence is a product of hsa-miR-9-5p, hsa-miR-9, miR-9, miR-9-5p, MIR9-3, MIR9-2, MIR9-1 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 15E1.2, 182-FIP, 19A, 1A1-3B, 2'-PDE, 2H9, 3'HEXO, 3635, 39K2.

Interactions 17

According to IntAct, Homo sapiens (human) hsa-miR-9-5p interacts with:

IntAct ID Participant Synonyms
EBI-20764578 intact:EBI-20750170 EBI-20750170 ENST00000425538.5 mrna_myocardin
EBI-20764633 intact:EBI-20765269 EBI-20765269 ENST00000255194.10 mrna_ap3b1
EBI-20765254 intact:EBI-20765277 EBI-20765277 ENST00000340828.6 mrna_ccng1
EBI-20765257 intact:EBI-20765587 EBI-20765587 ENST00000336314 mrna_larp1
EBI-20765260 intact:EBI-20765597 EBI-20765597 ENST00000367321.7 mrna_mthfd1l
EBI-20765263 intact:EBI-20765605 EBI-20765605 ENST00000394053 mrna_mthfd2
EBI-20765684 intact:EBI-20765605 EBI-20765605 ENST00000394053 mrna_mthfd2
EBI-20765266 intact:EBI-20765614 EBI-20765614 ENST00000373825 mrna_srpk1
EBI-20765898 intact:EBI-20765910 EBI-20765910 ENST00000306503 mrna_socs5
EBI-20798148 intact:EBI-20800396 EBI-20800396 ENST00000407236 mrna_ppara
EBI-20798165 intact:EBI-20800410 EBI-20800410 ENST00000261769 mrna_cdh1 human
EBI-20813302 intact:EBI-20800410 EBI-20800410 ENST00000261769 mrna_cdh1 human
EBI-20816916 intact:EBI-20800410 EBI-20800410 ENST00000261769 mrna_cdh1 human
EBI-20819073 intact:EBI-20819129 EBI-20819129 ENST00000260302 mrna_mmp13
EBI-25566765 P33469 7a EBI-25566551 N Nucleocapsid protein P33469 Q6TNF5 ncap_cvhoc
EBI-25566780 P33469 7a EBI-25566551 N Nucleocapsid protein P33469 Q6TNF5 ncap_cvhoc
EBI-25566812 P33469 7a EBI-25566551 N Nucleocapsid protein P33469 Q6TNF5 ncap_cvhoc

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCUUUGGUUAUCUAGCUGUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 90 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-9a
    2. Aedes aegypti aae-miR-9a
    3. Alligator mississippiensis (American alligator) Ami-Mir-9-P1_5p (mature (guide))
    4. Anolis carolinensis (green anole) Aca-Mir-9-P2_5p (mature (guide))
    5. Anopheles gambiae (African malaria mosquito) aga-miR-9a
    6. Apis mellifera (honey bee) ame-miR-9a-5p
    7. Ascaris suum asu-miR-9-5p
    8. Ateles geoffroyi age-miR-9
    9. Blattella germanica (German cockroach) Bge-Mir-9-o14_5p (mature (guide))
    10. Bombyx mori (domestic silkworm) bmo-miR-9a-5p
    11. Bos taurus Bta-Mir-9-P1_5p (mature (guide))
    12. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-9-5p
    13. Branchiostoma floridae (Florida lancelet) Bfl-Mir-9-P6_5p (mature (guide))
    14. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-9
    15. Callorhinchus milii eshark_mir-9_1
    16. Canis lupus familiaris cfa-miR-9
    17. Capitella teleta cte-miR-9-5p
    18. Capra hircus (goat) chi-miR-9-5p
    19. Cavia porcellus (domestic guinea pig) cpo-miR-9-5p
    20. Chrysemys picta bellii (western painted turtle) Cpi-Mir-9-P1_5p (mature (guide))
    21. Chrysemys picta (Painted turtle) cpi-miR-9-5p
    22. Cochliomyia hominivorax mature cho-miR-9a-5p
    23. Cochliomyia macellaria mature cma-miR-9a-5p
    24. Columba livia (rock pigeon) cli-miR-9-5p
    25. Crassostrea gigas Cgi-Mir-9-P12_5p (mature (guide))
    26. Danio rerio dre-miR-9-5p
    27. Daphnia pulex dpu-miR-9-5p
    28. Dasypus novemcinctus dno-miR-9-5p
    29. Dinoponera quadriceps dqu-miR-9-5p
    30. Drosophila ananassae dan-miR-9a
    31. Drosophila erecta der-miR-9a
    32. Drosophila grimshawi dgr-miR-9a
    33. Drosophila melanogaster (fruit fly) dme-miR-9a-5p
    34. Drosophila mojavensis dmo-miR-9a
    35. Drosophila persimilis dpe-miR-9a
    36. Drosophila pseudoobscura dps-miR-9a
    37. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294529_df_nrg
    38. Drosophila sechellia dse-miR-9a
    39. Drosophila simulans dsi-miR-9a
    40. Drosophila virilis dvi-miR-9a-5p
    41. Drosophila willistoni dwi-miR-9a
    42. Drosophila yakuba dya-miR-9a
    43. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-9-P1_5p (mature (guide))
    44. Eisenia fetida Efe-Mir-9-P16_5p (mature (guide))
    45. Equus caballus eca-miR-9a
    46. Eurosta solidaginis (goldenrod gall fly) miR-9
    47. Gadus morhua (Atlantic cod) gmo-miR-9-5p
    48. Gallus gallus gga-miR-9-5p
    49. Gorilla gorilla (western gorilla) ggo-miR-9
    50. Haemonchus contortus (barber pole worm) hco-miR-9
    51. Heligmosomoides polygyrus hpo-miR-9-5p
    52. Ictalurus punctatus ipu-miR-9
    53. Ixodes ricinus (castor bean tick) iri-miR-9a-5p
    54. Ixodes scapularis (black-legged tick) Isc-Mir-9_5p (mature (guide))
    55. Lagothrix lagotricha lla-miR-9
    56. Lingula anatina Lan-Mir-9_5p (mature (guide))
    57. Locusta migratoria lmi-miR-9a-5p
    58. Lottia gigantea (owl limpet) lgi-miR-9-5p
    59. Macaca mulatta (Rhesus monkey) mml-miR-9-5p
    60. Macaca nemestrina (pig-tailed macaque) mne-miR-9
    61. Maylandia zebra (zebra mbuna) mze-miR-9
    62. Melibe leonina mle-miR-9-5p
    63. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p
    64. Mus musculus mmu-miR-9-5p
    65. Nasonia giraulti ngi-miR-9a
    66. Nasonia longicornis nlo-miR-9a
    67. Nasonia vitripennis nvi-miR-9a
    68. Ornithorhynchus anatinus Oan-Mir-9-P3_5p (mature (guide))
    69. Oryctolagus cuniculus (rabbit) ocu-miR-9-5p
    70. Oryzias latipes ola-miR-9b-5p
    71. Pan troglodytes ptr-miR-9
    72. Paralichthys olivaceus pol-miR-9b-5p
    73. Parasteatoda tepidariorum (common house spider) pte-miR-9-5p
    74. Patiria miniata pmi-miR-9-5p
    75. Polistes canadensis pca-miR-9-5p
    76. Pongo pygmaeus ppy-miR-9
    77. Pteropus alecto (black flying fox) pal-miR-9-5p
    78. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
    79. Rattus norvegicus rno-miR-9a-5p
    80. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
    81. Salmo salar ssa-miR-9a-5p
    82. Scyliorhinus torazame Sto-Mir-9-P2_5p (mature (guide))
    83. Strongylocentrotus purpuratus Spu-Mir-9_5p (mature (guide))
    84. Sus scrofa ssc-miR-9-2
    85. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
    86. Takifugu rubripes fru-miR-9
    87. Tetraodon nigroviridis tni-miR-9
    88. Tor tambroides (Thai mahseer) miR-9-5p
    89. Triops cancriformis tcf-miR-9a-5p
    90. Tupaia chinensis (Chinese tree shrew) tch-miR-9-5p
    91. Xenopus tropicalis (tropical clawed frog) xtr-miR-9a-5p