Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-9 URS00004208C5_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUUGGUUAUCUAGCUGUAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 107 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-9a
  2. Aedes aegypti aae-miR-9a
  3. Alligator mississippiensis (American alligator) Ami-Mir-9-P1_5p (mature (guide))
  4. Anolis carolinensis Aca-Mir-9-P1_5p (mature (guide))
  5. Anopheles gambiae (African malaria mosquito) aga-miR-9a
  6. Apis mellifera ame-miR-9a-5p
  7. Ascaris suum asu-miR-9-5p
  8. Ateles geoffroyi (black-handed spider monkey) age-miR-9
  9. Blattella germanica (German cockroach) Bge-Mir-9-o13_5p (mature (guide))
  10. Bombyx mori bmo-miR-9a-5p
  11. Bos taurus Bta-Mir-9-P1_5p (mature (guide))
  12. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-9-5p
  13. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-9
  14. Callorhinchus milii Cmi-Mir-9-P1_5p (mature (guide))
  15. Canis lupus familiaris (dog) cfa-miR-9
  16. Capitella teleta cte-miR-9-5p
  17. Capra hircus (goat) chi-miR-9-5p
  18. Cavia porcellus (domestic guinea pig) cpo-miR-9-5p
  19. Centruroides sculpturatus (bark scorpion) Csc-Mir-9-P26_5p (mature (guide))
  20. Chrysemys picta bellii (western painted turtle) Cpi-Mir-9-P1_5p (mature (guide))
  21. Chrysemys picta (Painted turtle) cpi-miR-9-5p
  22. Cochliomyia hominivorax mature cho-miR-9a-5p
  23. Cochliomyia macellaria mature cma-miR-9a-5p
  24. Columba livia (rock pigeon) cli-miR-9-5p
  25. Crassostrea gigas (Pacific oyster) Cgi-Mir-9-P19_5p (mature (guide))
  26. Danio rerio (zebrafish) dre-miR-9-5p
  27. Daphnia magna Dma-Mir-9-o15_5p (mature (guide))
  28. Daphnia pulex (common water flea) dpu-miR-9-5p
  29. Dasypus novemcinctus (nine-banded armadillo) dno-miR-9-5p
  30. Dinoponera quadriceps dqu-miR-9-5p
  31. Drosophila ananassae dan-miR-9a
  32. Drosophila erecta der-miR-9a
  33. Drosophila grimshawi dgr-miR-9a
  34. Drosophila melanogaster (fruit fly) dme-miR-9a-5p
  35. Drosophila mojavensis dmo-miR-9a
  36. Drosophila persimilis dpe-miR-9a
  37. Drosophila pseudoobscura dps-miR-9a
  38. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294529_df_nrg
  39. Drosophila sechellia dse-miR-9a
  40. Drosophila simulans dsi-miR-9a
  41. Drosophila virilis dvi-miR-9a-5p
  42. Drosophila willistoni dwi-miR-9a
  43. Drosophila yakuba dya-miR-9a
  44. Echinops telfairi Ete-Mir-9-P1_5p (mature (guide))
  45. Eisenia fetida Efe-Mir-9-P21_5p (mature (guide))
  46. Eptatretus burgeri Ebu-Mir-9-P6_5p (mature (guide))
  47. Equus caballus eca-miR-9a
  48. Eurosta solidaginis (goldenrod gall fly) miR-9
  49. Gadus morhua (Atlantic cod) gmo-miR-9-5p
  50. Gallus gallus gga-miR-9-5p
  51. Gekko japonicus Gja-Mir-9-P1_5p (mature (guide))
  52. Gorilla gorilla gorilla ggo-miR-9 (MIR9)
  53. Haemonchus contortus (barber pole worm) hco-miR-9
  54. Heligmosomoides polygyrus hpo-miR-9-5p
  55. Homo sapiens (human) hsa-miR-9-5p
  56. Hyalella azteca miR-9
  57. Ictalurus punctatus (channel catfish) ipu-miR-9
  58. Ixodes ricinus iri-miR-9a-5p
  59. Ixodes scapularis (black-legged tick) Isc-Mir-9_5p (mature (guide))
  60. Lagothrix lagotricha lla-miR-9
  61. Latimeria chalumnae (coelacanth) Lch-Mir-9-P1_5p (mature (guide))
  62. Lepisosteus oculatus (spotted gar) Loc-Mir-9-P1_5p (mature (guide))
  63. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-9-P23_5p (mature (guide))
  64. Lingula anatina Lan-Mir-9_5p (mature (guide))
  65. Locusta migratoria lmi-miR-9a-5p
  66. Lottia gigantea (owl limpet) lgi-miR-9-5p
  67. Macaca mulatta (Rhesus monkey) mml-miR-9-5p
  68. Macaca nemestrina mne-miR-9
  69. Maylandia zebra mze-miR-9
  70. Melibe leonina mle-miR-9-5p
  71. Microcaecilia unicolor Mun-Mir-9-P1_5p (mature (guide))
  72. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p
  73. Monopterus albus (swamp eel) Mal-Mir-9-P1b_5p (mature (guide))
  74. Mus musculus mmu-miR-9-5p
  75. Nasonia giraulti ngi-miR-9a
  76. Nasonia longicornis nlo-miR-9a
  77. Nasonia vitripennis nvi-miR-9a
  78. Nautilus pompilius Npo-Mir-9_5p (mature (co-guide))
  79. Ornithorhynchus anatinus (platypus) Oan-Mir-9-P1_5p (mature (guide))
  80. Oryctolagus cuniculus (rabbit) ocu-miR-9-5p
  81. Oryzias latipes (Japanese medaka) ola-miR-9a-5p
  82. Pan troglodytes (chimpanzee) ptr-miR-9
  83. Paralichthys olivaceus pol-miR-9b-5p
  84. Parasteatoda tepidariorum (common house spider) pte-miR-9-5p
  85. Patiria miniata pmi-miR-9-5p
  86. Polistes canadensis pca-miR-9-5p
  87. Pongo pygmaeus (Bornean orangutan) ppy-miR-9
  88. Pteropus alecto (black flying fox) pal-miR-9-5p
  89. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
  90. Python bivittatus Pbv-Mir-9-P1_5p (mature (guide))
  91. Rattus norvegicus rno-miR-9a-5p
  92. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
  93. Salmo salar ssa-miR-9a-5p
  94. Sarcophilus harrisii Sha-Mir-9-P1_5p (mature (guide))
  95. Scyliorhinus torazame (cloudy catshark) Sto-Mir-9-P1_5p (mature (guide))
  96. Sphenodon punctatus Spt-Mir-9-P1_5p (mature (co-guide))
  97. Strongylocentrotus purpuratus (purple sea urchin) Spu-Mir-9_5p (mature (guide))
  98. Sus scrofa (pig) ssc-miR-9-2
  99. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
  100. Takifugu rubripes fru-miR-9
  101. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-9
  102. Tor tambroides miR-9-5p
  103. Tribolium castaneum Tca-Mir-9-o6_5p (mature (guide))
  104. Triops cancriformis tcf-miR-9a-5p
  105. Tupaia chinensis tch-miR-9-5p
  106. Xenopus laevis (African clawed frog) Xla-Mir-9-P1d_5p (mature (co-guide))
  107. Xenopus tropicalis (tropical clawed frog) xtr-miR-9a-5p