Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-9a-5p URS00004208C5_7460

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Apis mellifera. Annotated by 3 databases (miRBase, RefSeq, Ensembl Metazoa). Described in 5 papers. Apis mellifera (honey bee) ame-miR-9a-5p sequence is a product of Mir9a, miR-9a, ame-miR-9a, miR-9, GeneID_732512 genes. Found in the honey bee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCUUUGGUUAUCUAGCUGUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 870 other species

    1. Acyrthosiphon pisum api-miR-9a
    2. Aedes aegypti (yellow fever mosquito) aae-miR-9a
    3. Alligator mississippiensis (American alligator) Ami-Mir-9-P1_5p (mature (guide))
    4. Anolis carolinensis Aca-Mir-9-P1_5p (mature (guide))
    5. Anopheles gambiae aga-miR-9a
    6. Ascaris suum asu-miR-9-5p
    7. Ateles geoffroyi (black-handed spider monkey) age-miR-9
    8. Blattella germanica (German cockroach) Bge-Mir-9-o13_5p (mature (guide))
    9. Bombyx mori bmo-miR-9a-5p
    10. Bos taurus Bta-Mir-9-P1_5p (mature (guide))
    11. Branchiostoma belcheri bbe-miR-9-5p
    12. Branchiostoma floridae Bfl-Mir-9-P6_5p (mature (guide))
    13. Callithrix jacchus cja-miR-9
    14. Callorhinchus milii Cmi-Mir-9-P1_5p (mature (guide))
    15. Canis lupus familiaris cfa-miR-9
    16. Capitella teleta cte-miR-9-5p
    17. Capra hircus (goat) chi-miR-9-5p
    18. Cavia porcellus cpo-miR-9-5p
    19. Centruroides sculpturatus Csc-Mir-9-P26_5p (mature (guide))
    20. Chrysemys picta bellii (western painted turtle) Cpi-Mir-9-P1_5p (mature (guide))
    21. Chrysemys picta (Painted turtle) cpi-miR-9-5p
    22. Cochliomyia hominivorax mature cho-miR-9a-5p
    23. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-9a-5p
    24. Columba livia (rock pigeon) cli-miR-9-5p
    25. Crassostrea gigas (Pacific oyster) Cgi-Mir-9-P19_5p (mature (guide))
    26. Danio rerio (zebrafish) dre-miR-9-5p
    27. Daphnia magna Dma-Mir-9-o15_5p (mature (guide))
    28. Daphnia pulex (common water flea) dpu-miR-9-5p
    29. Dasypus novemcinctus dno-miR-9-5p
    30. Dinoponera quadriceps dqu-miR-9-5p
    31. Drosophila ananassae dan-miR-9a
    32. Drosophila erecta der-miR-9a
    33. Drosophila grimshawi dgr-miR-9a
    34. Drosophila melanogaster dme-miR-9a-5p
    35. Drosophila mojavensis dmo-miR-9a
    36. Drosophila persimilis dpe-miR-9a
    37. Drosophila pseudoobscura dps-miR-9a
    38. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294529_df_nrg
    39. Drosophila sechellia dse-miR-9a
    40. Drosophila simulans dsi-miR-9a
    41. Drosophila virilis dvi-miR-9a-5p
    42. Drosophila willistoni dwi-miR-9a
    43. Drosophila yakuba dya-miR-9a
    44. Echinops telfairi Ete-Mir-9-P1_5p (mature (guide))
    45. Eisenia fetida (common brandling worm) Efe-Mir-9-P21_5p (mature (guide))
    46. Eptatretus burgeri Ebu-Mir-9-P6_5p (mature (guide))
    47. Equus caballus eca-miR-9a
    48. Eurosta solidaginis (goldenrod gall fly) miR-9
    49. Gadus morhua gmo-miR-9-5p
    50. Gallus gallus (chicken) gga-miR-9-5p
    51. Gekko japonicus Gja-Mir-9-P1_5p (mature (guide))
    52. Gorilla gorilla (western gorilla) ggo-miR-9
    53. Haemonchus contortus hco-miR-9
    54. Heligmosomoides polygyrus hpo-miR-9-5p
    55. Homo sapiens hsa-miR-9-5p
    56. Hyalella azteca miR-9
    57. Ictalurus punctatus (channel catfish) ipu-miR-9
    58. Ixodes ricinus iri-miR-9a-5p
    59. Ixodes scapularis (black-legged tick) Isc-Mir-9_5p (mature (guide))
    60. Lagothrix lagotricha (brown woolly monkey) lla-miR-9
    61. Latimeria chalumnae Lch-Mir-9-P1_5p (mature (guide))
    62. Lepisosteus oculatus (spotted gar) Loc-Mir-9-P1_5p (mature (guide))
    63. Limulus polyphemus Lpo-Mir-9-P23_5p (mature (guide))
    64. Lingula anatina Lan-Mir-9_5p (mature (guide))
    65. Locusta migratoria lmi-miR-9a-5p
    66. Lottia gigantea lgi-miR-9-5p
    67. Macaca mulatta (Rhesus monkey) mml-miR-9-5p
    68. Macaca nemestrina mne-miR-9
    69. Maylandia zebra (zebra mbuna) mze-miR-9
    70. Melibe leonina mle-miR-9-5p
    71. Microcaecilia unicolor Mun-Mir-9-P1_5p (mature (guide))
    72. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p
    73. Monopterus albus Mal-Mir-9-P1b_5p (mature (guide))
    74. Mus musculus mmu-miR-9-5p
    75. Nasonia giraulti ngi-miR-9a
    76. Nasonia longicornis nlo-miR-9a
    77. Nasonia vitripennis nvi-miR-9a
    78. Nautilus pompilius Npo-Mir-9_5p (mature (co-guide))
    79. Ornithorhynchus anatinus (platypus) Oan-Mir-9-P1_5p (mature (guide))
    80. Oryctolagus cuniculus ocu-miR-9-5p
    81. Oryzias latipes (Japanese medaka) ola-miR-9a-5p
    82. Pan troglodytes ptr-miR-9
    83. Paralichthys olivaceus (Japanese flounder) pol-miR-9b-5p
    84. Parasteatoda tepidariorum (common house spider) pte-miR-9-5p
    85. Patiria miniata pmi-miR-9-5p
    86. Polistes canadensis pca-miR-9-5p
    87. Pongo pygmaeus ppy-miR-9
    88. Pteropus alecto pal-miR-9-5p
    89. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
    90. Python bivittatus (Burmese python) Pbv-Mir-9-P1_5p (mature (guide))
    91. Rattus norvegicus (Norway rat) rno-miR-9a-5p
    92. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
    93. Salmo salar ssa-miR-9a-5p
    94. Sarcophilus harrisii Sha-Mir-9-P1_5p (mature (guide))
    95. Scyliorhinus torazame Sto-Mir-9-P1_5p (mature (guide))
    96. Sphenodon punctatus (tuatara) Spt-Mir-9-P1_5p (mature (co-guide))
    97. Strongylocentrotus purpuratus Spu-Mir-9_5p (mature (guide))
    98. Sus scrofa (pig) ssc-miR-9-2
    99. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
    100. Takifugu rubripes (torafugu) fru-miR-9
    101. Tetraodon nigroviridis tni-miR-9
    102. Tor tambroides (Thai mahseer) miR-9-5p
    103. Tribolium castaneum Tca-Mir-9-o6_5p (mature (guide))
    104. Triops cancriformis tcf-miR-9a-5p
    105. Tupaia chinensis tch-miR-9-5p
    106. Xenopus laevis Xla-Mir-9-P1d_5p (mature (co-guide))
    107. Xenopus tropicalis xtr-miR-9a-5p
    Publications New