Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila ananassae dan-miR-9a URS00004208C5_7217

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Drosophila ananassae. Annotated by 2 databases (miRBase, Ensembl Metazoa). Described in 1 paper. Drosophila ananassae dan-miR-9a sequence is a product of FBtr0290601_df_nrg gene. Found in the Drosophila ananassae reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCUUUGGUUAUCUAGCUGUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 191 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-9a
    2. Aedes aegypti (yellow fever mosquito) aae-miR-9a
    3. Alligator mississippiensis Ami-Mir-9-P1_5p (mature (guide))
    4. Anolis carolinensis Aca-Mir-9-P2_5p (mature (guide))
    5. Anopheles gambiae (African malaria mosquito) aga-miR-9a
    6. Apis mellifera ame-miR-9a-5p
    7. Ascaris suum asu-miR-9-5p
    8. Ateles geoffroyi (black-handed spider monkey) age-miR-9
    9. Blattella germanica (German cockroach) Bge-Mir-9-o14_5p (mature (guide))
    10. Bombyx mori bmo-miR-9a-5p
    11. Bos taurus (cattle) Bta-Mir-9-P1_5p (mature (guide))
    12. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-9-5p
    13. Branchiostoma floridae Bfl-Mir-9-P6_5p (mature (guide))
    14. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-9
    15. Callorhinchus milii (elephant shark) eshark_mir-9_1
    16. Canis lupus familiaris (dog) cfa-miR-9
    17. Capitella teleta cte-miR-9-5p
    18. Capra hircus chi-miR-9-5p
    19. Cavia porcellus cpo-miR-9-5p
    20. Chrysemys picta bellii Cpi-Mir-9-P1_5p (mature (guide))
    21. Chrysemys picta cpi-miR-9-5p
    22. Cochliomyia hominivorax mature cho-miR-9a-5p
    23. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-9a-5p
    24. Columba livia cli-miR-9-5p
    25. Crassostrea gigas (Pacific oyster) Cgi-Mir-9-P12_5p (mature (guide))
    26. Danio rerio dre-miR-9-5p
    27. Daphnia pulex (common water flea) dpu-miR-9-5p
    28. Dasypus novemcinctus (nine-banded armadillo) dno-miR-9-5p
    29. Dinoponera quadriceps dqu-miR-9-5p
    30. Drosophila erecta der-miR-9a
    31. Drosophila grimshawi dgr-miR-9a
    32. Drosophila melanogaster (fruit fly) dme-miR-9a-5p
    33. Drosophila mojavensis dmo-miR-9a
    34. Drosophila persimilis dpe-miR-9a
    35. Drosophila pseudoobscura dps-miR-9a
    36. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294529_df_nrg
    37. Drosophila sechellia dse-miR-9a
    38. Drosophila simulans dsi-miR-9a
    39. Drosophila virilis dvi-miR-9a-5p
    40. Drosophila willistoni dwi-miR-9a
    41. Drosophila yakuba dya-miR-9a
    42. Echinops telfairi Ete-Mir-9-P1_5p (mature (guide))
    43. Eisenia fetida Efe-Mir-9-P16_5p (mature (guide))
    44. Equus caballus eca-miR-9a
    45. Eurosta solidaginis (goldenrod gall fly) miR-9
    46. Gadus morhua (Atlantic cod) gmo-miR-9-5p
    47. Gallus gallus (chicken) gga-miR-9-5p
    48. Gorilla gorilla (western gorilla) ggo-miR-9
    49. Haemonchus contortus hco-miR-9
    50. Heligmosomoides polygyrus hpo-miR-9-5p
    51. Homo sapiens (human) hsa-miR-9-5p
    52. Ictalurus punctatus ipu-miR-9
    53. Ixodes ricinus iri-miR-9a-5p
    54. Ixodes scapularis Isc-Mir-9_5p (mature (guide))
    55. Lagothrix lagotricha (brown woolly monkey) lla-miR-9
    56. Lingula anatina Lan-Mir-9_5p (mature (guide))
    57. Locusta migratoria (migratory locust) lmi-miR-9a-5p
    58. Lottia gigantea lgi-miR-9-5p
    59. Macaca mulatta mml-miR-9-5p
    60. Macaca nemestrina mne-miR-9
    61. Maylandia zebra (zebra mbuna) mze-miR-9
    62. Melibe leonina mle-miR-9-5p
    63. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p
    64. Mus musculus mmu-miR-9-5p
    65. Nasonia giraulti ngi-miR-9a
    66. Nasonia longicornis nlo-miR-9a
    67. Nasonia vitripennis (jewel wasp) nvi-miR-9a
    68. Ornithorhynchus anatinus Oan-Mir-9-P3_5p (mature (guide))
    69. Oryctolagus cuniculus ocu-miR-9-5p
    70. Oryzias latipes ola-miR-9a-5p
    71. Pan troglodytes (chimpanzee) ptr-miR-9
    72. Paralichthys olivaceus (Japanese flounder) pol-miR-9b-5p
    73. Parasteatoda tepidariorum pte-miR-9-5p
    74. Patiria miniata pmi-miR-9-5p
    75. Polistes canadensis pca-miR-9-5p
    76. Pongo pygmaeus ppy-miR-9
    77. Pteropus alecto (black flying fox) pal-miR-9-5p
    78. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
    79. Rattus norvegicus rno-miR-9a-5p
    80. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
    81. Salmo salar ssa-miR-9a-5p
    82. Scyliorhinus torazame (cloudy catshark) Sto-Mir-9-P2_5p (mature (guide))
    83. Strongylocentrotus purpuratus Spu-Mir-9_5p (mature (guide))
    84. Sus scrofa ssc-miR-9-1
    85. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
    86. Takifugu rubripes fru-miR-9
    87. Tetraodon nigroviridis tni-miR-9
    88. Tor tambroides miR-9-5p
    89. Triops cancriformis tcf-miR-9a-5p
    90. Tupaia chinensis (Chinese tree shrew) tch-miR-9-5p
    91. Xenopus tropicalis xtr-miR-9a-5p