Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-302d-3p URS000041E949_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-302d: Hsa-mir-302d is a microRNA that has been studied in relation to various aspects of cancer. It has been found that the levels of hsa-mir-302d, along with hsa-mir-154 and hsa-mir-23b, are positively correlated with receptor mRNA levels [PMC4682251]. A prognostic model has been developed using coefficients from Cox regression analysis, and the expression levels of hsa-miR-222, hsa-mir-302d, hsa-miR-646, and age are used to calculate a prognostic score [PMC5601660]. Real-time PCR experiments have shown that hsa-miR-19b, hsa-mir-302d, and hsa-miR-340 are significantly increased in expression [PMC4118176]. In a miRNA expression profiling study, it was found that several miRNAs including hsa-mir-21, hsa-mir-20a, and hsa-mir-92a were upregulated in colon cancer cells and were involved in various cellular processes [PMC9941246]. Additionally, it was observed that nine miRNAs including hsa-mir-302d belonged to the "miR-302" and "miR520" families [PMC5584237]. These findings suggest that the expression levels of microRNAs such as hsa-mir-302d may have implications for cancer prognosis and cellular processes.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGUGCUUCCAUGUUUGAGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Callithrix jacchus cja-miR-302d-3p
  2. Dasypus novemcinctus dno-miR-302d-3p
  3. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-430-P4_3p (mature (guide))
  4. Macaca mulatta (Rhesus monkey) mml-miR-302d
  5. Mus musculus mmu-miR-302d-3p
  6. Oryctolagus cuniculus (rabbit) ocu-miR-302d-3p
  7. Pan troglodytes (chimpanzee) ptr-miR-302d
  8. Pongo pygmaeus (Bornean orangutan) ppy-miR-302d
Publications