Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-144 URS000041D05E_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-144: Cfa-mir-144 is a microRNA that has been found to play a role in the regulation of transforming growth factor beta (TGFβ) through STAT1 repression [PMC3668254]. It is up-regulated at a specific time point and has the potential to influence TGFβ regulation [PMC3668254]. In contrast to tumor samples, the expression of cfa-mir-144, along with cfa-miR-32 and cfa-miR-374a, is not significantly different in metastatic samples [PMC5678797]. These miRNAs, along with hsa-miR-1246, which is known for its deregulation in plasma from breast cancer patients, were evaluated in plasma samples [PMC5678797]. Commercially available microRNA LNA PCR primer sets were used to measure the levels of cfa-mir-144, cfa-miR-32, cfa-miR-374a, and hsa-miR-1246 in each plasma sample [PMC5678797]. However, a study comparing metastatic and non-metastatic tumors found no significant differences in the expression of these miRNAs using PCR analysis [PMC9032658]. Additionally, levels of cfa-mir-144, cfa-miR-32 and cfa-miR-374a were found to be different between blood and tumor tissues [PMC9610006]. In summary, while there is evidence suggesting that cfa-mir-144 may be involved in TGFβ regulation and metastasis development through its dysregulation in breast cancer samples and plasma samples from patients with breast cancer. However further research is needed to fully understand its role.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUAUAGAUGAUGUACUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Bos taurus bta-miR-144
  2. Macaca nemestrina (pig-tailed macaque) mne-miR-144
  3. Mus musculus microRNA miR-144
  4. Pan paniscus ppa-miR-144
  5. Pan troglodytes (chimpanzee) ptr-miR-144
  6. Pongo pygmaeus (Bornean orangutan) ppy-miR-144
Publications