Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-185-5p URS00004176D4_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (miRBase, MirGeneDB, MalaCards, TarBase, LncBase, IntAct, RefSeq, GeneCards, ENA). Described in 60 papers. Homo sapiens (human) hsa-miR-185-5p sequence is a product of miR-185, miR-185-5p, MIR185, hsa-miR-185, hsa-miR-185-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 12R-LOX, 13CDNA73, 14-3-3, 14-3-3GAMMA, 14-3-3γ, 2'-PDE, 20D7-FC4, 2PP2A, 3635.

Interactions 5

According to IntAct, Homo sapiens (human) hsa-miR-185-5p interacts with:

IntAct ID Participant Synonyms
EBI-26369307 URS0000204428_9606 EBI-20585808 URS0000204428_9606 lncrn_neat1 human long
EBI-26366982 intact:EBI-26367072 EBI-26367072 ENST00000416167 mrna_igf2 long
EBI-26367096 intact:EBI-26367072 EBI-26367072 ENST00000416167 mrna_igf2 long
EBI-26369290 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human
EBI-26369302 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAGAGAAAGGCAGUUCCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus bta-miR-185
    2. Callithrix jacchus cja-miR-185
    3. Canis lupus familiaris cfa-miR-185
    4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
    5. Cervus elaphus (red deer) cel-miR-185
    6. Cricetulus griseus cgr-miR-185-5p
    7. Dasypus novemcinctus dno-miR-185-5p
    8. Gorilla gorilla ggo-miR-185
    9. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
    10. Mus musculus (house mouse) mmu-miR-185-5p
    11. Oryctolagus cuniculus ocu-miR-185-5p
    12. Pan troglodytes (chimpanzee) ptr-miR-185
    13. Pongo pygmaeus (Bornean orangutan) ppy-miR-185
    14. Pteropus alecto (black flying fox) pal-miR-185-5p
    15. Rattus norvegicus rno-miR-185-5p
    16. Sus scrofa (pig) ssc-miR-185
    17. Tupaia chinensis (Chinese tree shrew) tch-miR-185-5p