Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-185-5p URS00004176D4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-185: Hsa-mir-185 is a microRNA gene that has been linked to autism in several CNV studies [PMC3965395]. Expression levels of TrkB-T1 and hsa-mir-185* were not associated with variations in TrkB-T1 3′UTR sequence or the region containing DNA encoding hsa-mir-185 microRNA [PMC3382618]. Transfection of hsa-miR-107 and hsa-mir-185 induced an increase in the percentage of cells at the G1 phase of the cell cycle [PMC2722734]. Hsa-mir-185 has been found to be significantly associated with mitochondria in HEK293 cells [PMC3439422]. In breast cancer, hsa-mir-185 is part of a profile of critical regulation for the expression of mRNA-Smad7 and Smad7 protein [PMC6310970]. In colorectal cancer, high expression of hsa-mir-185 is associated with metastasis and an unfavorable clinical outcome [PMC6003936]. Hsa-mir-185 mimic was used for transfection in HEK 293T cells [PMC9064001]. Hsa-miR primers were used for various microRNAs, including hsa-mir-185, in a study involving plasma miRNAs as prognostic markers [PMC5981448]. Hsa-miR primers were also used to form a urinary diagnostic biomarker panel that included hsa-miR-425, hsa-miR-15b, and hsa-mir-92a among others [PMC4161864]. The expression level of miR-181a-1 was found to be higher in EC than in normal endometrial tissues [PMC4342183].

mRNA interactions 12 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-185
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-185
  3. Canis lupus familiaris (dog) cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus (Chinese hamster) cgr-miR-185-5p
  7. Dasypus novemcinctus dno-miR-185-5p
  8. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  9. Gorilla gorilla (western gorilla) ggo-miR-185
  10. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
  11. Mus musculus mmu-miR-185-5p
  12. Oryctolagus cuniculus ocu-miR-185-5p
  13. Pan troglodytes ptr-miR-185
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-185
  15. Pteropus alecto pal-miR-185-5p
  16. Rattus norvegicus (Norway rat) rno-miR-185-5p
  17. Sus scrofa ssc-miR-185
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-185-5p
Publications