Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-185-5p URS00004176D4_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MirGeneDB, RefSeq, miRBase, IntAct, PSICQUIC, MalaCards, GeneCards, LncBase, ENA, TarBase). Homo sapiens (human) hsa-miR-185-5p sequence is a product of miR-185, MIR185, hsa-miR-185-5p, hsa-miR-185, miR-185-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 12R-LOX, 13CDNA73, 14-3-3, 14-3-3GAMMA, 14-3-3γ, 2'-PDE, 20D7-FC4, 2PP2A, 3635.

Interactions 15

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-185-5p interacts with:

Interaction id Participant Synonyms
EBI-26369307 URS0000204428_9606 EBI-20585808 URS0000204428_9606 lncrn_neat1 human long
EBI-26366982 intact:EBI-26367072 EBI-26367072 ENST00000416167 mrna_igf2 long
EBI-26367096 intact:EBI-26367072 EBI-26367072 ENST00000416167 mrna_igf2 long
URS00004176D4_9606-0 P01130 P01130
URS00004176D4_9606-6 P01130 P01130
URS00004176D4_9606-1 P29323 P29323
URS00004176D4_9606-7 P29323 P29323
URS00004176D4_9606-2 Q12772 Q12772
URS00004176D4_9606-8 Q12772 Q12772
URS00004176D4_9606-3 Q13586 Q13586
URS00004176D4_9606-9 Q13586 Q13586
URS00004176D4_9606-4 Q15109 Q15109
URS00004176D4_9606-10 Q15109 Q15109
URS00004176D4_9606-11 Q92945 Q92945
URS00004176D4_9606-5 Q92945 Q92945

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAGAGAAAGGCAGUUCCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Bos taurus bta-miR-185
    2. Callithrix jacchus cja-miR-185
    3. Canis lupus familiaris cfa-miR-185
    4. Cavia porcellus cpo-miR-185-5p
    5. Cervus elaphus (red deer) cel-miR-185
    6. Cricetulus griseus (Chinese hamster) cgr-miR-185-5p
    7. Dasypus novemcinctus dno-miR-185-5p
    8. Gorilla gorilla (western gorilla) ggo-miR-185
    9. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
    10. Mus musculus mmu-miR-185-5p
    11. Oryctolagus cuniculus ocu-miR-185-5p
    12. Pan troglodytes ptr-miR-185
    13. Pongo pygmaeus ppy-miR-185
    14. Pteropus alecto pal-miR-185-5p
    15. Rattus norvegicus (Norway rat) rno-miR-185-5p
    16. Sus scrofa (pig) ssc-miR-185
    17. Tupaia chinensis tch-miR-185-5p
    Publications New