Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-185-5p URS00004176D4_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-185: Mmu-mir-185 is a type of microRNA that has been shown to play a role in regulating osteogenic differentiation of human jaw bone marrow mesenchymal stem cells [PMC9075730]. It has been found that miR-145 can decrease osteogenic differentiation of these cells by targeting semaphorin 3A [PMC9075730]. In addition to miR-145, other microRNAs such as miR-21, miR-148b-3p, mmu-mir-185, and miR-381 have also been found to have important roles in regulating osteogenic differentiation of human mesenchymal stem cells [PMC9075730]. In fact, the CRISPR-Cas9 deletion of mmu-mir-185 has been shown to promote osteogenic differentiation of primary bone-marrow mesenchymal cells [PMC7404082]. The expression level of mmu-mir-185 can be increased by using an mmu-mir-185 expression vector [PMC3708730]. This vector was found to increase the levels of miR-185 approximately fivefold compared to the control [PMC3708730]. Furthermore, the overexpression of miR-185 using this vector was found to affect the functional regulation of mCry1 3'UTR [PMC3708730]. The expression level of mmu-mir-185 has also been quantitated in mouse brain, liver, and heart using the TaqMan MicroRNA assay [PMC1635289]. It was found that mmu-mir 185 is weakly but ubiquitously expressed in these tissues [PMC1635289].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAGAAAGGCAGUUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-185
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-185
  3. Canis lupus familiaris (dog) cfa-miR-185
  4. Cavia porcellus (domestic guinea pig) cpo-miR-185-5p
  5. Cervus elaphus (red deer) cel-miR-185
  6. Cricetulus griseus (Chinese hamster) cgr-miR-185-5p
  7. Dasypus novemcinctus dno-miR-185-5p
  8. Gorilla gorilla gorilla ggo-miR-185 (MIR185)
  9. Gorilla gorilla (western gorilla) ggo-miR-185
  10. Homo sapiens (human) hsa-miR-185-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-185-5p
  12. Oryctolagus cuniculus ocu-miR-185-5p
  13. Pan troglodytes ptr-miR-185
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-185
  15. Pteropus alecto pal-miR-185-5p
  16. Rattus norvegicus (Norway rat) rno-miR-185-5p
  17. Sus scrofa ssc-miR-185
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-185-5p
Publications