Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 27 (SNORD27) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 27 (SNORD27) URS000041615F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD27: SNORD27 is a small nucleolar RNA (snoRNA) that plays a role in alternative splicing regulation. Transfection of col1a1-miR-29b resulted in a significant inhibition of SNORD27 expression, while transfection of CMV-miR-29b inhibited the expression of carnitine palmitoyltransferase 1b (Cpt1b) [PMC7746150]. Knockdown experiments using antisense oligonucleotides (ASO) showed that the snoRNA SNORD27 is crucial for alternative exon exclusion, as its depletion almost entirely abolished this process [PMC7200641]. Further minigene experiments, where the snoRNA targeting region was replaced, confirmed the requirement for a direct interaction between SNORD27 and its target [PMC7200641]. In terms of clinical relevance, recent reports have indicated that SNORD25, SNORD27, SNORD30, and SNORD31 are associated with the progression from smoldering to symptomatic multiple myeloma (MM) [PMC3766210]. These findings suggest that SNORD27 plays an important role in alternative splicing regulation and may have clinical implications in cancer progression.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCCAUGAUGAACACAAAAUGACAAGCAUAUGGCUGAACUUUCAAGUGAUGUCAUCUUACUACUGAGAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications