Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7a-5p URS0000416056_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, MalaCards, miRBase, LncBase, MirGeneDB, TarBase, GeneCards, RefSeq, IntAct, PSICQUIC). Homo sapiens (human) hsa-let-7a-5p sequence is a product of let-7a, let-7a-5p, let-7, MIRLET7A2, MIRLET7A3, hsa-let-7a, hsa-let-7a-5p, MIRLET7A1 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 15.5K, 156DAG, 182-FIP, 2'-PDE, 2610509L04Rik.

Interactions 6

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-let-7a-5p interacts with:

Interaction id Participant Synonyms
EBI-25598065 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25621071 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
URS0000416056_9606-0 P05231 P05231
URS0000416056_9606-1 P05231 P05231
URS0000416056_9606-2 P05231 P05231
URS0000416056_9606-3 P05231 P05231

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAGGUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 101 other species

    1. Alligator mississippiensis (American alligator) ami-let-7a-5p
    2. Anolis carolinensis aca-let-7a-5p
    3. Ascaris suum asu-let-7-5p
    4. Ateles geoffroyi (black-handed spider monkey) microRNA let-7a-1
    5. Blattella germanica (German cockroach) Bge-Let-7_5p (mature (guide))
    6. Bos taurus bta-let-7a-5p
    7. Branchiostoma belcheri bbe-let-7a-5p
    8. Branchiostoma floridae (Florida lancelet) bfl-let-7a-5p
    9. Branchiostoma lanceolatum Bla-Let-7-P3_5p (mature (guide))
    10. Brugia malayi bma-let-7
    11. Caenorhabditis brenneri cbn-let-7
    12. Caenorhabditis briggsae cbr-let-7
    13. Caenorhabditis elegans cel-let-7-5p
    14. Caenorhabditis remanei crm-let-7
    15. Callithrix jacchus cja-let-7a
    16. Callorhinchus milii Cmi-Let-7-P2b4_5p (mature (guide))
    17. Canis lupus familiaris cfa-let-7a
    18. Capra hircus (goat) chi-let-7a-5p
    19. Cavia porcellus cpo-let-7a-5p
    20. Centruroides sculpturatus Csc-Let-7-P18b_5p (mature (guide))
    21. Cervus elaphus (red deer) cel-let-7a
    22. Chiloscyllium plagiosum microRNA cpl-let-7e
    23. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2b4_5p (mature (guide))
    24. Chrysemys picta (Painted turtle) cpi-let-7a-5p
    25. Columba livia (rock pigeon) cli-let-7a-5p
    26. Crassostrea gigas (Pacific oyster) Cgi-Let-7_5p (mature (guide))
    27. Cricetulus griseus (Chinese hamster) cgr-let-7a
    28. Cyprinus carpio ccr-let-7a
    29. Danio rerio (zebrafish) dre-let-7a
    30. Dasypus novemcinctus dno-let-7a-5p
    31. Daubentonia madagascariensis dma-let-7a
    32. Echinops telfairi Ete-Let-7-P2a1_5p (mature (guide))
    33. Eptatretus burgeri Ebu-Let-7-P2o6_5p (mature (guide))
    34. Equus caballus eca-let-7a
    35. Euprymna scolopes Esc-Let-7_5p (mature (guide))
    36. Gadus morhua gmo-let-7a-5p
    37. Gallus gallus (chicken) gga-let-7a-5p
    38. Gekko japonicus Gja-Let-7-P2b4_5p (mature (guide))
    39. Gorilla gorilla (western gorilla) microRNA let-7a-1
    40. Haplochromis burtoni abu-let-7a
    41. Heligmosomoides polygyrus hpo-let-7-5p
    42. Ictalurus punctatus (channel catfish) ipu-let-7a
    43. Ixodes ricinus iri-let-7-5p
    44. Ixodes scapularis (black-legged tick) Isc-Let-7_5p (mature (guide))
    45. Lagothrix lagotricha (brown woolly monkey) microRNA let-7a-1
    46. Latimeria chalumnae Lch-Let-7-P2b4_5p (mature (guide))
    47. Lemur catta microRNA let-7a-1
    48. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b4_5p (mature (guide))
    49. Limulus polyphemus Lpo-Let-7-P17_5p (mature (guide))
    50. Lingula anatina Lan-Let-7_5p (mature (guide))
    51. Lottia gigantea lgi-let-7
    52. Macaca mulatta (Rhesus monkey) mml-let-7a-5p
    53. Macaca nemestrina microRNA let-7a-1
    54. Maylandia zebra (zebra mbuna) mze-let-7a
    55. Microcaecilia unicolor Mun-Let-7-P2b4_5p (mature (guide))
    56. Microcebus murinus mmr-let-7a
    57. Monodelphis domestica (gray short-tailed opossum) mdo-let-7a-5p
    58. Monopterus albus Mal-Let-7-P2b4b_5p (mature (guide))
    59. Mus musculus mmu-let-7a-5p
    60. Nautilus pompilius Npo-Let-7_5p (mature (guide))
    61. Neolamprologus brichardi nbr-let-7a
    62. Nomascus leucogenys nle-let-7a
    63. Octopus bimaculoides Obi-Let-7_5p (mature (guide))
    64. Octopus vulgaris Ovu-Let-7_5p (mature (guide))
    65. Ophiophagus hannah (king cobra) oha-let-7a-5p
    66. Oreochromis niloticus oni-let-7a
    67. Ornithorhynchus anatinus (platypus) Oan-Let-7-P2b4_5p (mature (guide))
    68. Oryctolagus cuniculus ocu-let-7a-5p
    69. Oryzias latipes (Japanese medaka) ola-let-7a
    70. Otolemur garnettii oga-let-7a
    71. Ovis aries (sheep) oar-let-7a
    72. Pan paniscus (pygmy chimpanzee) ppa-let-7a
    73. Pan troglodytes ptr-let-7a
    74. Papio hamadryas (hamadryas baboon) pha-let-7a
    75. Parasteatoda tepidariorum (common house spider) pte-let-7-5p
    76. Penaeus japonicus miR-let7
    77. Petromyzon marinus (sea lamprey) pma-let-7a
    78. Pongo pygmaeus ppy-let-7a
    79. Pristionchus pacificus ppc-let-7
    80. Pteropus alecto pal-let-7a-5p
    81. Ptychodera flava Pfl-Let-7_5p (mature (guide))
    82. Pundamilia nyererei pny-let-7a
    83. Python bivittatus (Burmese python) pbv-let-7a-5p
    84. Rattus norvegicus (Norway rat) rno-let-7a-5p
    85. synthetic construct RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*AP*GP*GP*UP*UP*GP*UP*AP*UP*AP*GP*UP*U)-3'... from None (PDB 4KRF, chain R)
    86. Saccoglossus kowalevskii sko-let-7
    87. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7a-1
    88. Saimiri boliviensis boliviensis sbo-let-7a
    89. Salmo salar ssa-let-7a-5p
    90. Sarcophilus harrisii Sha-Let-7-P2a1_5p (mature (guide))
    91. Scyliorhinus torazame Sto-Let-7-P2b3_5p (mature (guide))
    92. Sphenodon punctatus (tuatara) Spt-Let-7-P2b4_5p (mature (guide))
    93. Sus scrofa (pig) ssc-let-7a
    94. Taeniopygia guttata (zebra finch) tgu-let-7a-5p
    95. Takifugu rubripes (torafugu) fru-let-7a
    96. Tetraodon nigroviridis tni-let-7a
    97. Tor tambroides (Thai mahseer) let-7a
    98. Tursiops truncatus (common bottlenose dolphin) let-7a
    99. Xenopus laevis xla-let-7a-5p
    100. Xenopus tropicalis xtr-let-7a
    101. Xenoturbella bocki Xbo-Let-7_5p (mature (guide))
    Publications New