v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-let-7j-5p URS0000416056_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Gallus gallus (chicken) gga-let-7j-5p sequence is a product of let-7a-5p, MIRLET7F2, let-7j-5p, MIRLET7A2, gga-let-7a-5p, let-7, MIRLET7E, gga-let-7j, MIRLET7A3, let-7j, gga-let-7a, let-7a, gga-let-7j-5p genes. Found in the Gallus gallus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGAGGUAGUAGGUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 101 other species

    1. Alligator mississippiensis ami-let-7a-5p
    2. Anolis carolinensis (green anole) aca-let-7a-5p
    3. Ascaris suum (pig roundworm) asu-let-7-5p
    4. Ateles geoffroyi microRNA let-7a-1
    5. Blattella germanica (German cockroach) Bge-Let-7_5p (mature (guide))
    6. Bos taurus (cattle) bta-let-7a-5p
    7. Branchiostoma belcheri (Belcher's lancelet) bbe-let-7a-5p
    8. Branchiostoma floridae (Florida lancelet) bfl-let-7a-5p
    9. Branchiostoma lanceolatum Bla-Let-7-P3_5p (mature (guide))
    10. Brugia malayi bma-let-7
    11. Caenorhabditis brenneri cbn-let-7
    12. Caenorhabditis briggsae cbr-let-7
    13. Caenorhabditis elegans cel-let-7-5p
    14. Caenorhabditis remanei crm-let-7
    15. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7a
    16. Callorhinchus milii Cmi-Let-7-P2b4_5p (mature (guide))
    17. Canis lupus familiaris cfa-let-7a
    18. Capra hircus (goat) chi-let-7a-5p
    19. Cavia porcellus cpo-let-7a-5p
    20. Centruroides sculpturatus (bark scorpion) Csc-Let-7-P18b_5p (mature (guide))
    21. Cervus elaphus cel-let-7a
    22. Chiloscyllium plagiosum microRNA cpl-let-7e
    23. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2b4_5p (mature (guide))
    24. Chrysemys picta cpi-let-7a-5p
    25. Columba livia (rock pigeon) cli-let-7a-5p
    26. Crassostrea gigas (Pacific oyster) Cgi-Let-7_5p (mature (guide))
    27. Cricetulus griseus cgr-let-7a
    28. Cyprinus carpio (common carp) ccr-let-7a
    29. Danio rerio dre-let-7a
    30. Dasypus novemcinctus dno-let-7a-5p
    31. Daubentonia madagascariensis (aye-aye) dma-let-7a
    32. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2a1_5p (mature (guide))
    33. Eptatretus burgeri Ebu-Let-7-P2o6_5p (mature (guide))
    34. Equus caballus (horse) eca-let-7a
    35. Euprymna scolopes Esc-Let-7_5p (mature (guide))
    36. Gadus morhua gmo-let-7a-5p
    37. Gekko japonicus Gja-Let-7-P2b4_5p (mature (guide))
    38. Gorilla gorilla (western gorilla) microRNA let-7a-1
    39. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7a
    40. Heligmosomoides polygyrus hpo-let-7-5p
    41. Homo sapiens (human) hsa-let-7a-5p
    42. Ictalurus punctatus ipu-let-7a
    43. Ixodes ricinus iri-let-7-5p
    44. Ixodes scapularis Isc-Let-7_5p (mature (guide))
    45. Lagothrix lagotricha microRNA let-7a-1
    46. Latimeria chalumnae (coelacanth) Lch-Let-7-P2b4_5p (mature (guide))
    47. Lemur catta (Ring-tailed lemur) microRNA let-7a-1
    48. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b4_5p (mature (guide))
    49. Limulus polyphemus Lpo-Let-7-P17_5p (mature (guide))
    50. Lingula anatina Lan-Let-7_5p (mature (guide))
    51. Lottia gigantea lgi-let-7
    52. Macaca mulatta mml-let-7a-5p
    53. Macaca nemestrina (pig-tailed macaque) microRNA let-7a-1
    54. Maylandia zebra mze-let-7a
    55. Microcaecilia unicolor Mun-Let-7-P2b4_5p (mature (guide))
    56. Microcebus murinus mmr-let-7a
    57. Monodelphis domestica mdo-let-7a-5p
    58. Monopterus albus Mal-Let-7-P2b4b_5p (mature (guide))
    59. Mus musculus mmu-let-7a-5p
    60. Nautilus pompilius Npo-Let-7_5p (mature (guide))
    61. Neolamprologus brichardi nbr-let-7a
    62. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7a
    63. Octopus bimaculoides Obi-Let-7_5p (mature (guide))
    64. Octopus vulgaris (common octopus) Ovu-Let-7_5p (mature (guide))
    65. Ophiophagus hannah oha-let-7a-5p
    66. Oreochromis niloticus oni-let-7a
    67. Ornithorhynchus anatinus (platypus) Oan-Let-7-P2b4_5p (mature (guide))
    68. Oryctolagus cuniculus ocu-let-7a-5p
    69. Oryzias latipes ola-let-7a
    70. Otolemur garnettii (small-eared galago) oga-let-7a
    71. Ovis aries (sheep) oar-let-7a
    72. Pan paniscus ppa-let-7a
    73. Pan troglodytes ptr-let-7a
    74. Papio hamadryas pha-let-7a
    75. Parasteatoda tepidariorum pte-let-7-5p
    76. Penaeus japonicus miR-let7
    77. Petromyzon marinus pma-let-7a
    78. Pongo pygmaeus ppy-let-7a
    79. Pristionchus pacificus ppc-let-7
    80. Pteropus alecto pal-let-7a-5p
    81. Ptychodera flava Pfl-Let-7_5p (mature (guide))
    82. Pundamilia nyererei pny-let-7a
    83. Python bivittatus pbv-let-7a-5p
    84. Rattus norvegicus (Norway rat) rno-let-7a-5p
    85. synthetic construct RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*AP*GP*GP*UP*UP*GP*UP*AP*UP*AP*GP*UP*U)-3'... from None (PDB 4KRF, chain R)
    86. Saccoglossus kowalevskii sko-let-7
    87. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7a-1
    88. Saimiri boliviensis boliviensis sbo-let-7a
    89. Salmo salar ssa-let-7a-5p
    90. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P2a1_5p (mature (guide))
    91. Scyliorhinus torazame (cloudy catshark) Sto-Let-7-P2b3_5p (mature (guide))
    92. Sphenodon punctatus Spt-Let-7-P2b4_5p (mature (guide))
    93. Sus scrofa (pig) ssc-let-7a
    94. Taeniopygia guttata (zebra finch) tgu-let-7a-5p
    95. Takifugu rubripes (torafugu) fru-let-7a
    96. Tetraodon nigroviridis tni-let-7a
    97. Tor tambroides (Thai mahseer) let-7a
    98. Tursiops truncatus let-7a
    99. Xenopus laevis xla-let-7a-5p
    100. Xenopus tropicalis (tropical clawed frog) xtr-let-7a
    101. Xenoturbella bocki Xbo-Let-7_5p (mature (guide))
     Publications