Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-let-7a URS0000416056_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (MirGeneDB, RefSeq, miRBase, ENA). Described in 23 papers. Danio rerio (zebrafish) dre-let-7a sequence is a product of mirlet7a-5, dre-let-7a, mirlet7a-6, mirlet7a-4, mirlet7a-1, mirlet7a-2, mirlet7a-3, let-7, let-7a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGGUAGUAGGUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 85 other species

    1. Alligator mississippiensis (American alligator) ami-let-7a-5p
    2. Anolis carolinensis (green anole) aca-let-7a-5p
    3. Ascaris suum asu-let-7-5p
    4. Ateles geoffroyi microRNA let-7a-1
    5. Blattella germanica Bge-Let-7_5p (mature (guide))
    6. Bos taurus bta-let-7a-5p
    7. Branchiostoma belcheri (Belcher's lancelet) bbe-let-7a-5p
    8. Branchiostoma floridae bfl-let-7a-5p
    9. Brugia malayi bma-let-7
    10. Caenorhabditis brenneri cbn-let-7
    11. Caenorhabditis briggsae cbr-let-7
    12. Caenorhabditis elegans cel-let-7-5p
    13. Caenorhabditis remanei crm-let-7
    14. Callithrix jacchus cja-let-7a
    15. Callorhinchus milii eshark_let-7_2
    16. Canis lupus familiaris cfa-let-7a
    17. Capra hircus chi-let-7a-5p
    18. Cavia porcellus (domestic guinea pig) cpo-let-7a-5p
    19. Cervus elaphus (red deer) cel-let-7a
    20. Chiloscyllium plagiosum microRNA cpl-let-7e
    21. Chrysemys picta bellii Cpi-Let-7-P2b4_5p (mature (guide))
    22. Chrysemys picta cpi-let-7a-5p
    23. Columba livia (rock pigeon) cli-let-7a-5p
    24. Crassostrea gigas (Pacific oyster) Cgi-Let-7_5p (mature (guide))
    25. Cricetulus griseus cgr-let-7a
    26. Cyprinus carpio (common carp) ccr-let-7a
    27. Dasypus novemcinctus dno-let-7a-5p
    28. Daubentonia madagascariensis dma-let-7a
    29. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2a1_5p (mature (guide))
    30. Equus caballus (horse) eca-let-7a
    31. Gadus morhua gmo-let-7a-5p
    32. Gallus gallus (chicken) gga-let-7j-5p
    33. Gorilla gorilla microRNA let-7a-1
    34. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7a
    35. Heligmosomoides polygyrus hpo-let-7-5p
    36. Homo sapiens (human) hsa-let-7a-5p
    37. Ictalurus punctatus ipu-let-7a
    38. Ixodes ricinus iri-let-7-5p
    39. Ixodes scapularis (black-legged tick) Isc-Let-7_5p (mature (guide))
    40. Lagothrix lagotricha microRNA let-7a-1
    41. Lemur catta (Ring-tailed lemur) microRNA let-7a-1
    42. Lingula anatina Lan-Let-7_5p (mature (guide))
    43. Lottia gigantea (owl limpet) lgi-let-7
    44. Macaca mulatta (Rhesus monkey) mml-let-7a-5p
    45. Macaca nemestrina microRNA let-7a-1
    46. Maylandia zebra (zebra mbuna) mze-let-7a
    47. Microcebus murinus (gray mouse lemur) mmr-let-7a
    48. Monodelphis domestica mdo-let-7a-5p
    49. Mus musculus (house mouse) mmu-let-7a-5p
    50. Neolamprologus brichardi nbr-let-7a
    51. Nomascus leucogenys nle-let-7a
    52. Ophiophagus hannah oha-let-7a-5p
    53. Oreochromis niloticus oni-let-7a
    54. Ornithorhynchus anatinus Oan-Let-7-P2b4_5p (mature (guide))
    55. Oryctolagus cuniculus ocu-let-7a-5p
    56. Oryzias latipes ola-let-7a
    57. Otolemur garnettii (small-eared galago) oga-let-7a
    58. Ovis aries oar-let-7a
    59. Pan paniscus ppa-let-7a
    60. Pan troglodytes (chimpanzee) ptr-let-7a
    61. Papio hamadryas (hamadryas baboon) pha-let-7a
    62. Parasteatoda tepidariorum pte-let-7-5p
    63. Penaeus japonicus miR-let7
    64. Petromyzon marinus pma-let-7a
    65. Pongo pygmaeus (Bornean orangutan) ppy-let-7a
    66. Pristionchus pacificus ppc-let-7
    67. Pteropus alecto (black flying fox) pal-let-7a-5p
    68. Ptychodera flava Pfl-Let-7_5p (mature (guide))
    69. Pundamilia nyererei pny-let-7a
    70. Python bivittatus pbv-let-7a-5p
    71. Rattus norvegicus rno-let-7a-5p
    72. synthetic construct RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*AP*GP*GP*UP*UP*GP*UP*AP*UP*AP*GP*UP*U)-3'... from None (PDB 4KRF, chain R)
    73. Saccoglossus kowalevskii sko-let-7
    74. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7a-1
    75. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-let-7a
    76. Salmo salar (Atlantic salmon) ssa-let-7a-5p
    77. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P2a1_5p (mature (guide))
    78. Scyliorhinus torazame Sto-Let-7-P1b_5p (mature (guide))
    79. Sus scrofa (pig) ssc-let-7a
    80. Taeniopygia guttata tgu-let-7a-5p
    81. Takifugu rubripes (torafugu) fru-let-7a
    82. Tetraodon nigroviridis tni-let-7a
    83. Tor tambroides (Thai mahseer) let-7a
    84. Tursiops truncatus (common bottlenose dolphin) let-7a
    85. Xenopus laevis (African clawed frog) xla-let-7a-5p
    86. Xenopus tropicalis xtr-let-7a