Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-627-5p URS000040FA88_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-627: Hsa-mir-627 is a microRNA that has been studied in relation to cancer [PMC4035288]. It has been found to be down-regulated in G3, except for hsa-mir-627 and Hsa-miR-581 [PMC4035288]. Hsa-mir-627 has been proposed to have an unexpected role as an inhibitor of proliferation of colon cancer cells [PMC4035288]. It has also been associated with poor prognosis in lung adenocarcinoma (LUAD) [PMC7940991]. Hsa-mir-627, along with hsa-miR-577, hsa-miR-1, and hsa-miR-532-3p, can down-regulate the translation efficiency of CYP3A4 mRNA in the liver [PMC4876377]. Hsa-mir-627 has also been identified as a marker for early mortality and lead exposure [PMC9917942][PMC9509380]. In addition, it is one of the miRNAs that can be used as a biomarker for response to therapeutics involving CYP3A4 [PMC7014347]. Hsa-mir-627 is one of the miRNAs that can distinguish between different types of lymphomas [PMC4335255]. Overall, hsa-mir-627 plays a role in cancer proliferation and prognosis, as well as in the regulation of CYP3A4 mRNA translation efficiency.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGUCUCUAAGAAAAGAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-627
Publications