Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1305 URS000040EC3B_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (IntAct, RefSeq, GeneCards, miRBase, LncBase, ENA, TarBase). Described in 15 papers. Homo sapiens (human) hsa-miR-1305 sequence is a product of MIR1305, miR-1305, hsa-miR-1305 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 182-FIP, 3D3, 3pK, 4.1B, 82-FIP, A26C2, AASD-PPT, AASDHPPT, AC, ACAC.

Interactions 1

According to IntAct, Homo sapiens (human) hsa-miR-1305 interacts with:

Interaction id Participant Synonyms
EBI-26365883 intact:EBI-26365861 EBI-26365861 ENST00000646651 mrna_ube2t

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUUCAACUCUAAUGGGAGAGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.