Homo sapiens (human) hsa-miR-1305

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1305 URS000040EC3B_9606

22 nucleotides
8 databases (ENA, GeneCards, IntAct, LncBase, MalaCards, miRBase, RefSeq, TarBase)
Found in 0 other species
242 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1305: hsa-mir-1305, along with hsa-miR-1205, hsa-miR-579, and hsa-miR-607, has been predicted to bind with circ_0088300 [PMC8188357]. However, the specific biological function of hsa-mir-1305 in PDLSC (periodontal ligament stem cells) remains unknown [PMC5379007].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUUUCAACUCUAAUGGGAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications