Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-100-5p URS000040D674_10090

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 23 papers. Mus musculus (house mouse) mmu-miR-100-5p sequence is a product of Mir100, mmu-miR-100-5p, miR-100, mmu-miR-100, miR-100-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2610206G21Rik, 636931, ASNRS, ENSMUSG00000024587, ENSMUSG00000079259, LOC382112, Lin41, Nars, Trim71, lin-41.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACCCGUAGAUCCGAACUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 74 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-100
    2. Alligator mississippiensis (American alligator) ami-miR-100-5p
    3. Anolis carolinensis (green anole) aca-miR-100
    4. Anopheles gambiae aga-miR-100
    5. Apis mellifera (honey bee) ame-miR-100-5p
    6. Ateles geoffroyi age-miR-100
    7. Blattella germanica Bge-Mir-10-P2_5p (mature (guide))
    8. Bombyx mori bmo-miR-100
    9. Bos taurus bta-miR-100
    10. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-100-5p
    11. Brugia malayi bma-miR-100b
    12. Callithrix jacchus cja-miR-100
    13. Capra hircus miR-100
    14. Cavia porcellus (domestic guinea pig) cpo-miR-100-5p
    15. Chrysemys picta bellii Cpi-Mir-10-P2a_5p (mature (guide))
    16. Columba livia (rock pigeon) cli-miR-100-5p
    17. Crassostrea gigas (Pacific oyster) Cgi-Mir-10-P2_5p (mature (guide))
    18. Culex quinquefasciatus (southern house mosquito) cqu-miR-100-5p
    19. Danio rerio (zebrafish) dre-miR-100-5p
    20. Daphnia pulex (common water flea) Dpu-Mir-10-P2_5p (mature (guide))
    21. Dasypus novemcinctus dno-miR-100-5p
    22. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P2a_5p (mature (guide))
    23. Equus caballus (horse) eca-miR-100
    24. Gadus morhua gmo-miR-100a-5p
    25. Gallus gallus (chicken) gga-miR-100-5p
    26. Gorilla gorilla ggo-miR-100
    27. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-100
    28. Homo sapiens (human) hsa-miR-100-5p
    29. Ictalurus punctatus ipu-miR-100
    30. Ixodes ricinus iri-miR-100-5p
    31. Ixodes scapularis (black-legged tick) Isc-Mir-10-P2_5p (mature (guide))
    32. Lagothrix lagotricha lla-miR-100
    33. Lingula anatina Lan-Mir-10-P2_5p (mature (guide))
    34. Lottia gigantea (owl limpet) lgi-miR-100
    35. Macaca mulatta (Rhesus monkey) mml-miR-100-5p
    36. Manduca sexta mse-miR-100
    37. Maylandia zebra (zebra mbuna) mze-miR-100
    38. Microcebus murinus (gray mouse lemur) mmr-miR-100
    39. Monodelphis domestica Mdo-Mir-10-P2a_5p (mature (guide))
    40. Nasonia vitripennis (jewel wasp) nvi-miR-100
    41. Neolamprologus brichardi nbr-miR-100
    42. Nomascus leucogenys nle-miR-100
    43. Oreochromis niloticus oni-miR-100
    44. Ornithorhynchus anatinus oan-miR-100-5p
    45. Oryctolagus cuniculus ocu-miR-100-5p
    46. Otolemur garnettii (small-eared galago) oga-miR-100
    47. Ovis aries miscellaneous RNA
    48. Pan paniscus ppa-miR-100
    49. Pan troglodytes (chimpanzee) ptr-miR-100
    50. Papio hamadryas (hamadryas baboon) pha-miR-100
    51. Parasteatoda tepidariorum pte-miR-100b-5p
    52. Patiria miniata Pmi-Mir-10-P2_5p (mature (guide))
    53. Penaeus japonicus miR-100
    54. Petromyzon marinus pma-miR-100a-5p
    55. Pongo pygmaeus (Bornean orangutan) ppy-miR-100
    56. Pteropus alecto (black flying fox) pal-miR-100-5p
    57. Ptychodera flava Pfl-Mir-10-P2_5p (mature (guide))
    58. Pundamilia nyererei pny-miR-100
    59. Python bivittatus pbv-miR-100-5p
    60. Rattus norvegicus rno-miR-100-5p
    61. Saccoglossus kowalevskii sko-miR-100
    62. Saguinus labiatus (red-chested mustached tamarin) sla-miR-100
    63. Salmo salar (Atlantic salmon) ssa-miR-100a-5p
    64. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P2a_5p (mature (guide))
    65. Scyliorhinus torazame Sto-Mir-10-P2a_5p (mature (guide))
    66. Sus scrofa (pig) ssc-miR-100
    67. Taeniopygia guttata Tgu-Mir-10-P2a3_5p (mature (guide))
    68. Takifugu rubripes (torafugu) fru-miR-100
    69. Tetraodon nigroviridis tni-miR-100
    70. Tor tambroides (Thai mahseer) miR-100-5p
    71. Tribolium castaneum (red flour beetle) Tca-Mir-10-P2_5p (mature (guide))
    72. Triops cancriformis tcf-miR-100
    73. Tupaia chinensis (Chinese tree shrew) tch-miR-100-5p
    74. Xenopus laevis (African clawed frog) xla-miR-100-5p
    75. Xenopus tropicalis xtr-miR-100