Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans cel-miR-124-3p URS000040D400_6239

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Caenorhabditis elegans. Annotated by 5 databases (MirGeneDB, miRBase, WormBase, ENA, RefSeq). Caenorhabditis elegans cel-miR-124-3p sequence is a product of 124, cel-miR-124, cel-miR-124-3p, miR-124-3p, mir-124,b, 124,, mir-124, miR-124, 124,b genes. Found in the Caenorhabditis elegans reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAGGCACGCGGUGAAUGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Acyrthosiphon pisum api-miR-124
    2. Aedes aegypti (yellow fever mosquito) Aae-Mir-124_3p (mature (guide))
    3. Alligator mississippiensis (American alligator) ami-miR-124-3p
    4. Anolis carolinensis aca-miR-124a
    5. Ascaris suum asu-miR-124-3p
    6. Bactrocera dorsalis (oriental fruit fly) bdo-miR-124
    7. Caenorhabditis brenneri cbn-miR-124
    8. Caenorhabditis briggsae cbr-miR-124a
    9. Canis lupus familiaris cfa-miR-124
    10. Capitella teleta cte-miR-124
    11. Chrysemys picta (Painted turtle) cpi-miR-124-3p
    12. Crassostrea gigas (Pacific oyster) Cgi-Mir-124-P28_3p (mature (guide))
    13. Dinoponera quadriceps dqu-miR-124-3p
    14. Drosophila ananassae miR-124-RA
    15. Drosophila erecta miR-124-RA
    16. Drosophila persimilis miR-124-RA
    17. Drosophila pseudoobscura pseudoobscura miR-124-RA
    18. Drosophila willistoni miR-124-RA
    19. Drosophila yakuba miR-124-RA
    20. Echinococcus granulosus egr-miR-124a-3p
    21. Echinococcus multilocularis emu-miR-124a-3p
    22. Gadus morhua gmo-miR-124-3p
    23. Heliconius melpomene (postman butterfly) Hme-Mir-124_3p (mature (guide))
    24. Heligmosomoides polygyrus hpo-miR-124-3p
    25. Lingula anatina Lan-Mir-124_3p (mature (co-guide))
    26. Lottia gigantea lgi-miR-124
    27. Lytechinus variegatus lva-miR-124-3p
    28. Manduca sexta (tobacco hornworm) mse-miR-124
    29. Melibe leonina mle-miR-124-3p
    30. Mus musculus Mus_musculus piRNA piR-mmu-8160608
    31. Ornithorhynchus anatinus (platypus) oan-miR-124a-1-3p
    32. Oryzias latipes (Japanese medaka) ola-miR-124-3p
    33. Petromyzon marinus (sea lamprey) pma-miR-124-3p
    34. Pundamilia nyererei pny-miR-124
    35. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62826
    36. Schmidtea mediterranea sme-miR-124c-3p
    37. Strongylocentrotus purpuratus spu-miR-124
    38. Sus scrofa (pig) ssc-miR-124a
    39. Taeniopygia guttata (zebra finch) tgu-miR-124-3p
    40. Tetranychus urticae tur-miR-124-3p
    41. Xenopus laevis xla-miR-124-3p
    Publications New