Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-153 precursor (hsa-mir-153-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-153 precursor (hsa-mir-153-2) URS000040ABF2_9606

  • 87 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, miRBase, RefSeq, Rfam)
  • Found in 109 species

Automated summary: This pre miRNA sequence is 87 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Rfam, RefSeq, HGNC, GeneCards, miRBase, Ensembl/GENCODE, ENA, Ensembl). Described in 37 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-153, RF00650). Homo sapiens (human) microRNA hsa-mir-153 precursor (hsa-mir-153-2) sequence is a product of MIR153-2, ENSG00000207960.1, 153-2, mir-153-2 precursor, 2, 153, mir-153, mir-153-2, hsa-mir-153-2 precursor, mir-153-2 precurso genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 108 other species

    1. Aotus nancymaae microRNA 153-2 (ENSANAG00000006294.1)
    2. Balaenoptera musculus (Blue whale) microRNA 153-2 (ENSBMSG00010010565.1)
    3. Bos grunniens (domestic yak) microRNA 153-2 (ENSBGRG00000014070.1)
    4. Bos indicus x Bos taurus (hybrid cattle) microRNA 153-2 (ENSBIXG00000007497.1, ENSBIXG00005016777.1)
    5. Bos mutus (wild yak) microRNA 153-2 (ENSBMUG00000002222.1)
    6. Bos taurus microRNA bta-mir-153 precursor (bta-mir-153-2)
    7. Callithrix jacchus microRNA mir-153
    8. Camelus dromedarius microRNA 153-2 (ENSCDRG00005015530.1)
    9. Camelus ferus microRNA mir-153
    10. Carlito syrichta microRNA 153-2 (ENSTSYG00000021728.2)
    11. Catagonus wagneri microRNA 153-2 (ENSCWAG00000005966.1)
    12. Cavia porcellus microRNA mir-153
    13. Cercocebus atys (Sooty mangabey) microRNA 153-2 (ENSCATG00000042851.1)
    14. Cervus elaphus hippelaphus ncRNA
    15. Cervus hanglu yarkandensis (Yarkand deer) microRNA 153-2 (ENSCHYG00000017764.1)
    16. Chlorocebus sabaeus microRNA 153-2 (ENSCSAG00000022812.1)
    17. Choloepus hoffmanni microRNA 153-2 (ENSCHOG00000014997.1)
    18. Colobus angolensis palliatus microRNA 153-2 (ENSCANG00000016880.1)
    19. Dasypus novemcinctus (nine-banded armadillo) microRNA 153-2 (ENSDNOG00000026629.1)
    20. Delphinapterus leucas (beluga whale) microRNA 153-2 (ENSDLEG00000014538.1)
    21. Equus caballus microRNA 153-2 (ENSECAG00000025363.2)
    22. Fukomys damarensis microRNA mir-153
    23. Gorilla gorilla gorilla ggo-mir-153 (ENSGGOG00000029699.2)
    24. Gorilla gorilla (western gorilla) microRNA ggo-mir-153 precursor
    25. Loxodonta africana (African savanna elephant) microRNA 153-2 (ENSLAFG00000024583.1)
    26. Macaca fascicularis miRNA (ENSMFAG00000017863.2)
    27. Macaca mulatta microRNA mml-mir-153 precursor (mml-mir-153-2)
    28. Macaca nemestrina microRNA mne-mir-153 precursor (mne-mir-153-2)
    29. Mandrillus leucophaeus (Drill) microRNA 153-2 (ENSMLEG00000020005.1, ENSMLEG00000020034.1)
    30. Marmota marmota marmota (Alpine marmot) microRNA 153-2 (ENSMMMG00000024400.1)
    31. Mesocricetus auratus microRNA mir-153
    32. Microcebus murinus (gray mouse lemur) microRNA 153-2 (ENSMICG00000019580.3)
    33. Monodon monoceros (narwhal) microRNA 153-2 (ENSMMNG00015012709.1)
    34. Moschus moschiferus microRNA 153-2 (ENSMMSG00000006440.1)
    35. Neotoma lepida microRNA mir-153
    36. Nomascus leucogenys microRNA 153-2 (ENSNLEG00000019453.2)
    37. Oryctolagus cuniculus microRNA 153-2 (ENSOCUG00000018047.1)
    38. Otolemur garnettii microRNA 153-2 (ENSOGAG00000017512.1)
    39. Pan paniscus microRNA 153-2 (ENSPPAG00000019873.1)
    40. Pan troglodytes ptr-mir-153 (ENSPTRG00000049513.1)
    41. Papio anubis microRNA 153-2 (ENSPANG00000008991.2)
    42. Peromyscus maniculatus bairdii miRNA (ENSPEMG00000001118.2)
    43. Piliocolobus tephrosceles miRNA (ENSPTEG00000011913.1)
    44. Pongo abelii microRNA 153-2 (ENSPPYG00000021612.1)
    45. Pongo pygmaeus microRNA ppy-mir-153 precursor (ppy-mir-153-2)
    46. Procavia capensis microRNA 153-2 (ENSPCAG00000019295.1)
    47. Prolemur simus (greater bamboo lemur) microRNA 153-2 (ENSPSMG00000010063.1)
    48. Propithecus coquereli microRNA 153-2 (ENSPCOG00000010073.1)
    49. Pteropus alecto microRNA mir-153
    50. Pteropus vampyrus microRNA 153-2 (ENSPVAG00000026765.1)
    51. Rattus norvegicus microRNA rno-mir-153 precursor
    52. Rhinopithecus bieti microRNA 153-2 (ENSRBIG00000014680.1)
    53. Rhinopithecus roxellana microRNA 153-2 (ENSRROG00000009423.1)
    54. Saimiri boliviensis boliviensis microRNA 153-2 (ENSSBOG00000001179.1)
    55. Spermophilus dauricus miRNA (ENSSDAG00000002348.1)
    56. Ictidomys tridecemlineatus microRNA mir-153
    57. Sus scrofa microRNA ssc-mir-153 precursor
    58. Theropithecus gelada microRNA 153-2 (ENSTGEG00000008130.1)
    59. Tursiops truncatus microRNA 153-2 (ENSTTRG00000024223.1)
    60. Urocitellus parryii (Arctic ground squirrel) microRNA 153-2 (ENSUPAG00010000082.1)
    2D structure New