Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-561-5p URS000040828B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-561: Hsa-mir-561 is a microRNA that has been identified in various studies to be associated with different types of cancers, including prostate cancer (PCa) [PMC8426106], colon cancer (COAD) [PMC6937800], papillary renal cell carcinoma [PMC6937800], hepatocellular carcinoma (HCC) [PMC7723630], and mammary gland cancer in goats and cattle [PMC4608672]. In PCa, hsa-mir-561 is one of the 22 upregulated differentially expressed microRNAs that can predict gene expression regulation [PMC8426106]. In COAD, hsa-mir-561 is one of the seven microRNAs with a positive coefficient, indicating its driving effect on COAD development and progression [PMC6937800]. In papillary renal cell carcinoma, hsa-mir-561 has been identified as a prognostic biomarker [PMC6937800]. In HCC, hsa-mir-561 is one of the three miRNAs that may serve as possible prognostic predictors for the disease [PMC7723630]. Furthermore, hsa-mir-561 has been found to be upregulated in hepatocellular carcinoma tissues compared to normal tissues [PMC6889128]. The function of the mir-561 family in mammary gland cancer is not yet known but its seed region suggests its association with this family in goats and cattle. The expression levels of hsa-mir-561 have also been found to be altered in various other cancers such as colon cancer and HCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAAGGAUCUUAAACUUUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla ggo-miR-561 (MIR561)
  2. Gorilla gorilla (western gorilla) ggo-miR-561
  3. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-561
Publications