Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-138 URS000040780F_9860

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Cervus elaphus. Annotated by 1 database (ENA). Cervus elaphus (red deer) cel-miR-138 sequence is a product of cel-miR-138, miR-138 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUGGUGUUGUGAAUCAGGCCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Alligator mississippiensis Ami-Mir-138-P2_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-138-P2_5p (mature (guide))
    3. Bos taurus bta-miR-138
    4. Callorhinchus milii Cmi-Mir-138-P1_5p (mature (guide))
    5. Canis lupus familiaris (dog) cfa-miR-138a
    6. Cavia porcellus (domestic guinea pig) cpo-miR-138-5p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-138-P2_5p (mature (co-guide))
    8. Columba livia (rock pigeon) cli-miR-138-5p
    9. Danio rerio dre-miR-138-5p
    10. Dasypus novemcinctus dno-miR-138-5p
    11. Echinops telfairi Ete-Mir-138-P2_5p (mature (guide))
    12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-138-P4_5p (mature (guide))
    13. Equus caballus eca-miR-138
    14. Gadus morhua (Atlantic cod) Gmo-Mir-138-P1b_5p (mature (guide))
    15. Gallus gallus (chicken) Gga-Mir-138-P2_5p (mature (guide))
    16. Gekko japonicus Gja-Mir-138-P2_5p (mature (guide))
    17. Gorilla gorilla ggo-miR-138
    18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-138
    19. Homo sapiens (human) hsa-miR-138-5p
    20. Ictalurus punctatus ipu-miR-138
    21. Latimeria chalumnae Lch-Mir-138-P2_5p (mature (guide))
    22. Lepisosteus oculatus Loc-Mir-138-P2_5p (mature (guide))
    23. Macaca fascicularis (crab-eating macaque) microRNA miR-138-5p
    24. Macaca mulatta (Rhesus monkey) mml-miR-138-5p
    25. Maylandia zebra (zebra mbuna) mze-miR-138
    26. Microcaecilia unicolor Mun-Mir-138-P1_5p (mature (guide))
    27. Microcebus murinus (gray mouse lemur) mmr-miR-138
    28. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-138-P2_5p (mature (guide))
    29. Monopterus albus Mal-Mir-138-P2_5p (mature (guide))
    30. Mus musculus (house mouse) mmu-miR-138-5p
    31. Neolamprologus brichardi nbr-miR-138
    32. Ophiophagus hannah oha-miR-138-5p
    33. Oreochromis niloticus (Nile tilapia) oni-miR-138
    34. Ornithorhynchus anatinus oan-miR-138-5p
    35. Oryctolagus cuniculus (rabbit) ocu-miR-138-5p
    36. Otolemur garnettii oga-miR-138
    37. Pan troglodytes (chimpanzee) ptr-miR-138
    38. Petromyzon marinus (sea lamprey) pma-miR-138a
    39. Pongo pygmaeus ppy-miR-138
    40. Pteropus alecto pal-miR-138-5p
    41. Pundamilia nyererei pny-miR-138
    42. Python bivittatus pbv-miR-138-5p
    43. Rattus norvegicus (Norway rat) rno-miR-138-5p
    44. Salmo salar ssa-miR-138-5p
    45. Sarcophilus harrisii sha-miR-138
    46. Scyliorhinus torazame Sto-Mir-138-P1_5p (mature (guide))
    47. Sphenodon punctatus (tuatara) Spt-Mir-138-P2_5p (mature (guide))
    48. Taeniopygia guttata (zebra finch) tgu-miR-138-5p
    49. Tetraodon nigroviridis Tni-Mir-138-P2_5p (mature (guide))
    50. Xenopus laevis (African clawed frog) xla-miR-138-5p
    51. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-138-P1_5p (mature (guide))