Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-138-P2_5p (mature (guide)) URS000040780F_9371

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Echinops telfairi. Annotated by 1 database (MirGeneDB). Described in 1 paper. Found in the small madagascar hedgehog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUGGUGUUGUGAAUCAGGCCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-138-P2_5p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-138-P2_5p (mature (guide))
    3. Bos taurus bta-miR-138
    4. Canis lupus familiaris cfa-miR-138a
    5. Cavia porcellus (domestic guinea pig) cpo-miR-138-5p
    6. Cervus elaphus (red deer) cel-miR-138
    7. Chrysemys picta bellii Cpi-Mir-138-P2_5p (mature (co-guide))
    8. Columba livia (rock pigeon) cli-miR-138-5p
    9. Danio rerio (zebrafish) dre-miR-138-5p
    10. Dasypus novemcinctus dno-miR-138-5p
    11. Equus caballus (horse) eca-miR-138
    12. Gallus gallus (chicken) Gga-Mir-138-P2_5p (mature (guide))
    13. Gorilla gorilla ggo-miR-138
    14. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-138
    15. Homo sapiens (human) hsa-miR-138-5p
    16. Ictalurus punctatus ipu-miR-138
    17. Macaca fascicularis microRNA miR-138-5p
    18. Macaca mulatta (Rhesus monkey) mml-miR-138-5p
    19. Maylandia zebra (zebra mbuna) mze-miR-138
    20. Microcebus murinus (gray mouse lemur) mmr-miR-138
    21. Monodelphis domestica Mdo-Mir-138-P2_5p (mature (guide))
    22. Mus musculus (house mouse) mmu-miR-138-5p
    23. Neolamprologus brichardi nbr-miR-138
    24. Ophiophagus hannah oha-miR-138-5p
    25. Oreochromis niloticus oni-miR-138
    26. Ornithorhynchus anatinus oan-miR-138-5p
    27. Oryctolagus cuniculus ocu-miR-138-5p
    28. Otolemur garnettii (small-eared galago) oga-miR-138
    29. Pan troglodytes (chimpanzee) ptr-miR-138
    30. Petromyzon marinus pma-miR-138a
    31. Pongo pygmaeus (Bornean orangutan) ppy-miR-138
    32. Pteropus alecto (black flying fox) pal-miR-138-5p
    33. Pundamilia nyererei pny-miR-138
    34. Python bivittatus pbv-miR-138-5p
    35. Rattus norvegicus rno-miR-138-5p
    36. Salmo salar (Atlantic salmon) ssa-miR-138-5p
    37. Sarcophilus harrisii (Tasmanian devil) sha-miR-138
    38. Scyliorhinus torazame Sto-Mir-138-P1_5p (mature (guide))
    39. Taeniopygia guttata tgu-miR-138-5p
    40. Xenopus laevis (African clawed frog) xla-miR-138-5p
    41. Xenopus tropicalis Xtr-Mir-138-P1_5p (mature (guide))