Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) Gga-Mir-138-P2_5p (mature (guide)) URS000040780F_9031

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Gallus gallus. Annotated by 2 databases (MirGeneDB, PirBase). Described in 1 paper. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUGGUGUUGUGAAUCAGGCCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 91 other species

    1. Alligator mississippiensis Ami-Mir-138-P2_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-138-P2_5p (mature (guide))
    3. Bos taurus (cattle) bta-miR-138
    4. Canis lupus familiaris (dog) cfa-miR-138a
    5. Cavia porcellus cpo-miR-138-5p
    6. Cervus elaphus (red deer) cel-miR-138
    7. Chrysemys picta bellii Cpi-Mir-138-P2_5p (mature (co-guide))
    8. Columba livia cli-miR-138-5p
    9. Danio rerio dre-miR-138-5p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-138-5p
    11. Echinops telfairi Ete-Mir-138-P2_5p (mature (guide))
    12. Equus caballus eca-miR-138
    13. Gorilla gorilla (western gorilla) ggo-miR-138
    14. Haplochromis burtoni abu-miR-138
    15. Homo sapiens (human) hsa-miR-138-5p
    16. Ictalurus punctatus ipu-miR-138
    17. Macaca fascicularis microRNA miR-138-5p
    18. Macaca mulatta mml-miR-138-5p
    19. Maylandia zebra (zebra mbuna) mze-miR-138
    20. Microcebus murinus (gray mouse lemur) mmr-miR-138
    21. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-138-P2_5p (mature (guide))
    22. Mus musculus mmu-miR-138-5p
    23. Neolamprologus brichardi nbr-miR-138
    24. Ophiophagus hannah oha-miR-138-5p
    25. Oreochromis niloticus (Nile tilapia) oni-miR-138
    26. Ornithorhynchus anatinus oan-miR-138-5p
    27. Oryctolagus cuniculus ocu-miR-138-5p
    28. Otolemur garnettii oga-miR-138
    29. Pan troglodytes (chimpanzee) ptr-miR-138
    30. Petromyzon marinus (sea lamprey) pma-miR-138a
    31. Pongo pygmaeus ppy-miR-138
    32. Pteropus alecto (black flying fox) pal-miR-138-5p
    33. Pundamilia nyererei pny-miR-138
    34. Python bivittatus pbv-miR-138-5p
    35. Rattus norvegicus rno-miR-138-5p
    36. Salmo salar ssa-miR-138-5p
    37. Sarcophilus harrisii (Tasmanian devil) sha-miR-138
    38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-138-P1_5p (mature (guide))
    39. Taeniopygia guttata (zebra finch) tgu-miR-138-5p
    40. Xenopus laevis xla-miR-138-5p
    41. Xenopus tropicalis Xtr-Mir-138-P1_5p (mature (guide))