Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) xla-miR-138-5p URS000040780F_8355

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Xenopus laevis. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUGGUGUUGUGAAUCAGGCCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-138-P2_5p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-138-P2_5p (mature (guide))
    3. Bos taurus bta-miR-138
    4. Canis lupus familiaris cfa-miR-138a
    5. Cavia porcellus (domestic guinea pig) cpo-miR-138-5p
    6. Cervus elaphus (red deer) cel-miR-138
    7. Chrysemys picta bellii Cpi-Mir-138-P2_5p (mature (co-guide))
    8. Columba livia (rock pigeon) cli-miR-138-5p
    9. Danio rerio (zebrafish) dre-miR-138-5p
    10. Dasypus novemcinctus dno-miR-138-5p
    11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-138-P2_5p (mature (guide))
    12. Equus caballus (horse) eca-miR-138
    13. Gallus gallus (chicken) Gga-Mir-138-P2_5p (mature (guide))
    14. Gorilla gorilla ggo-miR-138
    15. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-138
    16. Homo sapiens (human) hsa-miR-138-5p
    17. Ictalurus punctatus ipu-miR-138
    18. Macaca fascicularis microRNA miR-138-5p
    19. Macaca mulatta (Rhesus monkey) mml-miR-138-5p
    20. Maylandia zebra (zebra mbuna) mze-miR-138
    21. Microcebus murinus (gray mouse lemur) mmr-miR-138
    22. Monodelphis domestica Mdo-Mir-138-P2_5p (mature (guide))
    23. Mus musculus (house mouse) mmu-miR-138-5p
    24. Neolamprologus brichardi nbr-miR-138
    25. Ophiophagus hannah oha-miR-138-5p
    26. Oreochromis niloticus oni-miR-138
    27. Ornithorhynchus anatinus oan-miR-138-5p
    28. Oryctolagus cuniculus ocu-miR-138-5p
    29. Otolemur garnettii (small-eared galago) oga-miR-138
    30. Pan troglodytes (chimpanzee) ptr-miR-138
    31. Petromyzon marinus pma-miR-138a
    32. Pongo pygmaeus (Bornean orangutan) ppy-miR-138
    33. Pteropus alecto (black flying fox) pal-miR-138-5p
    34. Pundamilia nyererei pny-miR-138
    35. Python bivittatus pbv-miR-138-5p
    36. Rattus norvegicus rno-miR-138-5p
    37. Salmo salar (Atlantic salmon) ssa-miR-138-5p
    38. Sarcophilus harrisii (Tasmanian devil) sha-miR-138
    39. Scyliorhinus torazame Sto-Mir-138-P1_5p (mature (guide))
    40. Taeniopygia guttata tgu-miR-138-5p
    41. Xenopus tropicalis Xtr-Mir-138-P1_5p (mature (guide))