Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 8) secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 8) URS0000403DE2_559292

Automated summary: This tRNA sequence is 73 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (ENA, IntAct, GtRNAdb). Described in 17 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 8) sequence is a product of tRNA-Phe-GAA-2-3, tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-4, tRNA-Phe-GAA-2-5, tRNA-Phe-GAA-2-7, tRNA-Phe-GAA-2-2, tRNA-Phe-GAA-2-8, tRNA-Phe-GAA-2-6 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 6

According to IntAct, Saccharomyces cerevisiae S288C tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 8) interacts with:

Interaction id Participant Synonyms
EBI-12521668 P31115 D6VTN0 DEG1 Depressed growth-rate protein DEG1 EBI-14284 HRM3 P31115 PUS3 YFL001W pus3_yeast tRNA pseudouridine synthase 3 tRNA pseudouridylate synthase 3 tRNA-uridine isomerase 3
EBI-12516200 P38205 D6VPX6 EBI-11933 Multisite-specific tRNA:m5C-methyltransferase NCL1 P38205 TRM4 YBL024W YBL0437 ncl1_yeast tRNA (cytosine-5-)-methyltransferase NCL1 tRNA methyltransferase 4
EBI-12517633 P38205 D6VPX6 EBI-11933 Multisite-specific tRNA:m5C-methyltransferase NCL1 P38205 TRM4 YBL024W YBL0437 ncl1_yeast tRNA (cytosine-5-)-methyltransferase NCL1 tRNA methyltransferase 4
EBI-12520720 P38238 2'-O-ribose RNA methyltransferase TRM7 D6VQ61 EBI-21457 P38238 TRM7 YBR0527 YBR061C tRNA methylase 7 trm7_yeast
EBI-12520115 P48567 D6W0Q1 EBI-14291 N0480 P48567 PUS4 YNL292W pus4_yeast tRNA pseudouridine(55) synthase tRNA pseudouridylate synthase 4 tRNA-uridine isomerase 4
EBI-11701339 Q12400 D6W1X5 EBI-29692 O0926 Q12400 TRM10 YOL093W tRNA methyltransferase 10 tRNA(m1G9)-methyltransferase trm10_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 185 other species

    1. [Ashbya] aceris (nom. inval.) tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    2. Eremothecium cymbalariae DBVPG#7215 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    3. Eremothecium gossypii ATCC 10895 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    4. Eremothecium gossypii FDAG1 tRNA-Phe
    5. Eremothecium sinecaudum tRNA-Phe
    6. Kazachstania africana CBS 2517 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
    7. Kazachstania naganishii CBS 8797 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    8. Kazachstania saulgeensis transfer RNA-Phe-(GAA)
    9. Lachancea dasiensis tRNA-Phe (GAA) cove score=69.01
    10. Lachancea dasiensis tRNA-Phe (GAA) cove score=67.47
    11. Lachancea kluyveri NRRL Y-12651 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    12. Lachancea lanzarotensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
    13. Lachancea meyersii CBS 8951 tRNA-Phe (GAA) cove score=68.23
    14. Lachancea mirantina tRNA-Phe (GAA) cove score=67.05
    15. Lachancea nothofagi CBS 11611 tRNA-Phe (GAA) cove score=68.50
    16. Lachancea quebecensis transfer RNA
    17. Lachancea sp. CBS 6924 tRNA-Phe (GAA) cove score=68.51
    18. Meyerozyma guilliermondii ATCC 6260 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
    19. Naumovozyma castellii CBS 4309 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 10)
    20. Saccharomyces arboricola H-6 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    21. Saccharomyces boulardii (nom. inval.) tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    22. Saccharomyces cerevisiae AWRI796 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    23. Saccharomyces cerevisiae transfer RNA-Phe
    24. Saccharomyces cerevisiae CBS 7960 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
    25. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    26. Saccharomyces cerevisiae CLIB215 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    27. Saccharomyces cerevisiae CLIB324 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    28. Saccharomyces cerevisiae CLIB382 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
    29. Saccharomyces cerevisiae EC1118 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    30. Saccharomyces cerevisiae EC9-8 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    31. Saccharomyces cerevisiae FL100 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
    32. Saccharomyces cerevisiae FostersB tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    33. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    34. Saccharomyces cerevisiae Lalvin QA23 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    35. Saccharomyces cerevisiae P283 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
    36. Saccharomyces cerevisiae P301 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
    37. Saccharomyces cerevisiae PE-2 tRNA-Phe
    38. Saccharomyces cerevisiae PW5 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
    39. Saccharomyces cerevisiae R008 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
    40. Saccharomyces cerevisiae R103 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
    41. Saccharomyces cerevisiae RM11-1a tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    42. Saccharomyces cerevisiae Sigma1278b tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    43. Saccharomyces cerevisiae T73 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    44. Saccharomyces cerevisiae T7 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    45. Saccharomyces cerevisiae UC5 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    46. Saccharomyces cerevisiae UFMG A-905 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    47. Saccharomyces cerevisiae Vin13 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    48. Saccharomyces cerevisiae VL3 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    49. Saccharomyces cerevisiae W303 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    50. Saccharomyces cerevisiae Y10 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    51. Saccharomyces cerevisiae YJM1078 tRNA-Phe
    52. Saccharomyces cerevisiae YJM1083 tRNA-Phe
    53. Saccharomyces cerevisiae YJM1129 tRNA-Phe
    54. Saccharomyces cerevisiae YJM1133 tRNA-Phe
    55. Saccharomyces cerevisiae YJM1190 tRNA-Phe
    56. Saccharomyces cerevisiae YJM1199 tRNA-Phe
    57. Saccharomyces cerevisiae YJM1202 tRNA-Phe
    58. Saccharomyces cerevisiae YJM1208 tRNA-Phe
    59. Saccharomyces cerevisiae YJM1242 tRNA-Phe
    60. Saccharomyces cerevisiae YJM1244 tRNA-Phe
    61. Saccharomyces cerevisiae YJM1248 tRNA-Phe
    62. Saccharomyces cerevisiae YJM1250 tRNA-Phe
    63. Saccharomyces cerevisiae YJM1252 tRNA-Phe
    64. Saccharomyces cerevisiae YJM1273 tRNA-Phe
    65. Saccharomyces cerevisiae YJM1304 tRNA-Phe
    66. Saccharomyces cerevisiae YJM1307 tRNA-Phe
    67. Saccharomyces cerevisiae YJM1311 tRNA-Phe
    68. Saccharomyces cerevisiae YJM1326 tRNA-Phe
    69. Saccharomyces cerevisiae YJM1332 tRNA-Phe
    70. Saccharomyces cerevisiae YJM1336 tRNA-Phe
    71. Saccharomyces cerevisiae YJM1338 tRNA-Phe
    72. Saccharomyces cerevisiae YJM1341 tRNA-Phe
    73. Saccharomyces cerevisiae YJM1342 tRNA-Phe
    74. Saccharomyces cerevisiae YJM1355 tRNA-Phe
    75. Saccharomyces cerevisiae YJM1356 tRNA-Phe
    76. Saccharomyces cerevisiae YJM1381 tRNA-Phe
    77. Saccharomyces cerevisiae YJM1383 tRNA-Phe
    78. Saccharomyces cerevisiae YJM1385 tRNA-Phe
    79. Saccharomyces cerevisiae YJM1386 tRNA-Phe
    80. Saccharomyces cerevisiae YJM1387 tRNA-Phe
    81. Saccharomyces cerevisiae YJM1388 tRNA-Phe
    82. Saccharomyces cerevisiae YJM1389 tRNA-Phe
    83. Saccharomyces cerevisiae YJM1399 tRNA-Phe
    84. Saccharomyces cerevisiae YJM1400 tRNA-Phe
    85. Saccharomyces cerevisiae YJM1401 tRNA-Phe
    86. Saccharomyces cerevisiae YJM1402 tRNA-Phe
    87. Saccharomyces cerevisiae YJM1415 tRNA-Phe
    88. Saccharomyces cerevisiae YJM1417 tRNA-Phe
    89. Saccharomyces cerevisiae YJM1418 tRNA-Phe
    90. Saccharomyces cerevisiae YJM1419 tRNA-Phe
    91. Saccharomyces cerevisiae YJM1433 tRNA-Phe
    92. Saccharomyces cerevisiae YJM1434 tRNA-Phe
    93. Saccharomyces cerevisiae YJM1439 tRNA-Phe
    94. Saccharomyces cerevisiae YJM1443 tRNA-Phe
    95. Saccharomyces cerevisiae YJM1444 tRNA-Phe
    96. Saccharomyces cerevisiae YJM1447 tRNA-Phe
    97. Saccharomyces cerevisiae YJM1450 tRNA-Phe
    98. Saccharomyces cerevisiae YJM1460 tRNA-Phe
    99. Saccharomyces cerevisiae YJM1463 tRNA-Phe
    100. Saccharomyces cerevisiae YJM1477 tRNA-Phe
    101. Saccharomyces cerevisiae YJM1478 tRNA-Phe
    102. Saccharomyces cerevisiae YJM1479 tRNA-Phe
    103. Saccharomyces cerevisiae YJM1526 tRNA-Phe
    104. Saccharomyces cerevisiae YJM1527 tRNA-Phe
    105. Saccharomyces cerevisiae YJM1549 tRNA-Phe
    106. Saccharomyces cerevisiae YJM1573 tRNA-Phe
    107. Saccharomyces cerevisiae YJM1574 tRNA-Phe
    108. Saccharomyces cerevisiae YJM1592 tRNA-Phe
    109. Saccharomyces cerevisiae YJM1615 tRNA-Phe
    110. Saccharomyces cerevisiae YJM189 tRNA-Phe
    111. Saccharomyces cerevisiae YJM193 tRNA-Phe
    112. Saccharomyces cerevisiae YJM195 tRNA-Phe
    113. Saccharomyces cerevisiae YJM244 tRNA-Phe
    114. Saccharomyces cerevisiae YJM248 tRNA-Phe
    115. Saccharomyces cerevisiae YJM269 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    116. Saccharomyces cerevisiae YJM270 tRNA-Phe
    117. Saccharomyces cerevisiae YJM271 tRNA-Phe
    118. Saccharomyces cerevisiae YJM320 tRNA-Phe
    119. Saccharomyces cerevisiae YJM326 tRNA-Phe
    120. Saccharomyces cerevisiae YJM428 tRNA-Phe
    121. Saccharomyces cerevisiae YJM450 tRNA-Phe
    122. Saccharomyces cerevisiae YJM451 tRNA-Phe
    123. Saccharomyces cerevisiae YJM453 tRNA-Phe
    124. Saccharomyces cerevisiae YJM456 tRNA-Phe
    125. Saccharomyces cerevisiae YJM470 tRNA-Phe
    126. Saccharomyces cerevisiae YJM541 tRNA-Phe
    127. Saccharomyces cerevisiae YJM554 tRNA-Phe
    128. Saccharomyces cerevisiae YJM555 tRNA-Phe
    129. Saccharomyces cerevisiae YJM627 tRNA-Phe
    130. Saccharomyces cerevisiae YJM681 tRNA-Phe
    131. Saccharomyces cerevisiae YJM682 tRNA-Phe
    132. Saccharomyces cerevisiae YJM683 tRNA-Phe
    133. Saccharomyces cerevisiae YJM689 tRNA-Phe
    134. Saccharomyces cerevisiae YJM693 tRNA-Phe
    135. Saccharomyces cerevisiae YJM969 tRNA-Phe
    136. Saccharomyces cerevisiae YJM972 tRNA-Phe
    137. Saccharomyces cerevisiae YJM975 tRNA-Phe
    138. Saccharomyces cerevisiae YJM978 tRNA-Phe
    139. Saccharomyces cerevisiae YJM981 tRNA-Phe
    140. Saccharomyces cerevisiae YJM984 tRNA-Phe
    141. Saccharomyces cerevisiae YJM987 tRNA-Phe
    142. Saccharomyces cerevisiae YJM990 tRNA-Phe
    143. Saccharomyces cerevisiae YJM993 tRNA-Phe
    144. Saccharomyces cerevisiae YJM996 tRNA-Phe
    145. Saccharomyces cerevisiae YJSH1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    146. Saccharomyces kudriavzevii IFO10990 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
    147. Saccharomyces kudriavzevii IFO 1802 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    148. Saccharomyces kudriavzevii ZP591 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
    149. Tetrapisispora blattae CBS 6284 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 3)
    150. Torulaspora delbrueckii tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
    151. Vanderwaltozyma polyspora DSM 70294 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 8)
    152. Yarrowia lipolytica CLIB122 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 14)
    153. Yarrowia lipolytica PO1f tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 13)
    154. Yarrowia lipolytica transfer RNA
    155. Yarrowia lipolytica WSH-Z06 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 14)
    156. Yarrowia sp. B02 tRNA-Phe
    157. Yarrowia sp. C11 tRNA-Phe
    158. Yarrowia sp. E02 tRNA-Phe
    159. Zygosaccharomyces rouxii tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
    2D structure New