v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 601 (LINC00601) URS0000403047_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00601: LINC00601 is a long intergenic non-protein coding RNA (lncRNA) that has been implicated in hepatocellular carcinoma (HCC) development [PMC9714191]. It has been found to be upregulated in HCC tissue [PMC8859324]. Studies have shown that LINC00601 can activate the MAPK signaling pathway, promoting HCC development [PMC9714191]. In addition, the downregulation of LINC00601 can suppress the activation of the MAPK signaling pathway and inhibit the proliferation of HCC cells [PMC8859324]. LINC00601 has also been identified as a potential biomarker for HCC treatment [PMC8859324]. Furthermore, a study identified LINC00601 as one of 14 lncRNAs associated with ferroptosis in HCC [PMC8691457]. The study validated the expression of LINC00601 and other lncRNAs using qRT-PCR and found significant differences in their expression levels [PMC8691457]. Moreover, LINC00601 has been included in prognostic models for HCC. It was identified as one of several risky RNAs associated with poor prognosis, while other RNAs were found to be protective factors [PMC7017795]. Overall, these findings suggest that LINC00601 plays a role in HCC development and may have potential as a therapeutic target or biomarker for this disease. However, further research is needed to fully understand its mechanisms and clinical implications.

Targeting miRNAs 2 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACUGCAUCAAAUGACCAACGGUCUGAGUAUGAGGCACAUCAGGGGCAGAACCAGAGAAGAGAAAGUACGGUGAUGUGGCUGCCCAACAGGAGGUCAGCUCACCCAGACAGCUUCCUCCAGCUCUGAAACAGAUCGACUGAGCACCAGAUGAAGUUGGCAUGGAUGGGAGAUGUGAUGUACAAGAGAAAAGCAAAAAUUACUUGAGUUAUCUCCCCGAAGUCAAAAGUAAUGGGACACGCAGACCCUCCUGAAAUUCUGAGCAGAAAUUGCUGCUACAUUUGAAUCAGAUUCUAAGAGAUCAUCAACAUUAGAAGGUGCACAUCAUAAUUCAAAUCUCUGAAGAGGAAGAAGGAAGAUAUUGACUUCAGUCUUCAUUUAGUCCUGUUAUGGGACUUCCAGACACUGAAAAAACUCAUCCCUACAGCCGGCUGGAGGAUAUUGUCCUGGAAGGGGCAGCUUUCACACAUGGUUUGAAUUCAAUUAGCCAGCUCCUCUGAGAGCCACUAGAGUACCAUUUAGGACAUUGCUUCUUGAAUUCUCAUUUGCAGCCUUGCAAAUAAUUUUCAAAGGUCAUUAGACCAUAAGGAGUUUUCAUUACCCUUCAUUCAUGUCAACAGCAAACACUUACUGAUUGAGCGUCCACUUGGUGCCCUAUGCUAGGUGCUUCCAGGUGCAUCCAAAAAGGGAUGCAGCACAAAAAAUUAAAAUGACUAGAAGCAGCAACACAUGGAAGGUAAAAAUCUUUCUAAUAAGAGCAAUGGAAGAAACAUUUCUACAAAUGUUAAGUUGUAAGUCAAAUGUUUUUAAAAAGAAAGAAAUGACAAAUUUGAUUAGACAAAAAUGAGAAACUGCUUGCUGUGGUCUCAAUGUGUCCCCCCAGAUUCAUAUGUUAAACCUUAAUUGCCAAUGUGAGAGUAUUACGAGGUAGGGACUUUAGGAGGUGAUUAAGUCUCUGCCUUCAUGAAUGGGAUUAGUGUCCUUACAAAAGAGGUGCAAGGAAGCUGCCCAUCCAUUCCACCACAUAAGGAUGCAUCCAAAGGUGCCAUCUGUGAAGCAGAGAAUGCCCUCACUAGACAUCAAACUAGACGUCAAACCUAAAUUGGCCUUGAUCUUGGGCUUCCCACCCUCCAGAACUGUGAGCAAUAAAUUUCUAUUUUUUAUAAAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications