Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7i-5p URS00004023EA_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (LncBase, RefSeq, MalaCards, miRBase, PSICQUIC, MirGeneDB, ENA, TarBase, GeneCards). Homo sapiens (human) hsa-let-7i-5p sequence is a product of hsa-let-7i, hsa-let-7i-5p, MIRLET7I, let-7i, let-7, let-7i-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 15.5K, 182-FIP, 2'-PDE, 2610509L04Rik, 2C4D.

Interactions 9

According to PSICQUIC, Homo sapiens (human) hsa-let-7i-5p interacts with:

Interaction id Participant Synonyms
URS00004023EA_9606-0 O00206 O00206
URS00004023EA_9606-4 O00206 O00206
URS00004023EA_9606-5 O00206 O00206
URS00004023EA_9606-6 P09429 P09429
URS00004023EA_9606-1 P09429 P09429
URS00004023EA_9606-7 P10145 P10145
URS00004023EA_9606-2 P10145 P10145
URS00004023EA_9606-3 P42081 P42081
URS00004023EA_9606-8 P42081 P42081

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAGUUUGUGCUGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 296 other species

    1. Alligator mississippiensis (American alligator) Ami-Let-7-P2c2_5p (mature (guide))
    2. Anolis carolinensis aca-let-7i-5p
    3. Bos taurus bta-let-7i
    4. Callithrix jacchus cja-let-7i
    5. Canis lupus familiaris Cfa-Let-7-P2c2_5p (mature (guide))
    6. Capra hircus (goat) chi-let-7i-5p
    7. Cavia porcellus cpo-let-7i-5p
    8. Cervus elaphus (red deer) cel-let-7i
    9. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2c2_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-let-7i-5p
    11. Danio rerio (zebrafish) dre-let-7i
    12. Dasypus novemcinctus dno-let-7i-5p
    13. Echinops telfairi Ete-Let-7-P2c2_5p (mature (guide))
    14. Gadus morhua Gmo-Let-7-P2c2b_5p (mature (guide))
    15. Gallus gallus (chicken) Gga-Let-7-P2c2_5p (mature (guide))
    16. Gekko japonicus Gja-Let-7-P2c2_5p (mature (guide))
    17. Haplochromis burtoni abu-let-7i
    18. Ictalurus punctatus (channel catfish) ipu-let-7i
    19. Latimeria chalumnae Lch-Let-7-P2c2_5p (mature (guide))
    20. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2c2_5p (mature (guide))
    21. Macaca mulatta (Rhesus monkey) mml-let-7i-5p
    22. Maylandia zebra (zebra mbuna) mze-let-7i
    23. Microcaecilia unicolor Mun-Let-7-P2c2_5p (mature (guide))
    24. Monodelphis domestica (gray short-tailed opossum) Mdo-Let-7-P2c2_5p (mature (guide))
    25. Monopterus albus Mal-Let-7-P2c2b_5p (mature (guide))
    26. Mus musculus mmu-let-7i-5p
    27. Neolamprologus brichardi nbr-let-7i
    28. Nomascus leucogenys nle-let-7i
    29. Ophiophagus hannah (king cobra) oha-let-7i-5p
    30. Oreochromis niloticus oni-let-7i
    31. Ornithorhynchus anatinus (platypus) Oan-Let-7-P2c2_5p (mature (guide))
    32. Oryctolagus cuniculus ocu-let-7i-5p
    33. Otolemur garnettii oga-let-7i
    34. Ovis aries (sheep) oar-let-7i
    35. Pan paniscus (pygmy chimpanzee) ppa-let-7i
    36. Pan troglodytes ptr-let-7i
    37. Papio hamadryas (hamadryas baboon) pha-let-7i
    38. Pongo pygmaeus ppy-let-7i
    39. Pteropus alecto pal-let-7i-5p
    40. Pundamilia nyererei pny-let-7i
    41. Python bivittatus (Burmese python) pbv-let-7i-5p
    42. Rattus norvegicus (Norway rat) rno-let-7i-5p
    43. Salmo salar ssa-let-7i-5p
    44. Sarcophilus harrisii Sha-Let-7-P2c2_5p (mature (guide))
    45. Sphenodon punctatus (tuatara) Spt-Let-7-P2c2_5p (mature (guide))
    46. Taeniopygia guttata (zebra finch) tgu-let-7i-5p
    47. Takifugu rubripes (torafugu) fru-let-7i
    48. Tetraodon nigroviridis tni-let-7i
    49. Tor tambroides (Thai mahseer) let-7i
    50. Tupaia chinensis tch-let-7i-5p
    51. Xenopus laevis Xla-Let-7-P2c2_5p (mature (guide))
    52. Xenopus tropicalis Xtr-Let-7-P2c2_5p (mature (guide))
    Publications New