Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4656 URS00003F7B61_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4656: Hsa-mir-4656 is associated with breast neoplasms [PMC9088870]. It shares common target genes with hsa-miR-21 and hsa-miR-612, suggesting similar biological processes [PMC9088870]. Hsa-mir-4656, along with other microRNAs such as hsa-mir-17 and hsa-mir-183-5p, showed increased fold change values [PMC9040239]. Hsa-mir-4656 is predicted to interact with hsa_circ_0086913 and is potentially involved in ceRNA regulation [PMC9395505]. It is also predicted to interact with the 3' UTR of PCSK9 along with other miRNAs [PMC5874276]. Hsa-mir-4656, along with hsa-miR-217-5p, is predicted to be a potential target of hsa_circ_0008362 [PMC7880344]. In the context of breast cancer, hsa-mir-4656 and other miRNAs such as hsa-miR-4680 and hsa-miR4467 have been associated with the disease and are significantly associated with patient survival rates [PMC4247319]. Hsa-miR21, hsa-miR612, and hsa_mir_4656 share common target genes in glioma patients, suggesting similar biological processes affected by these miRNAs [PMC4247319].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGCUGAGGGCAGGAGGCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications