Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-212-5p URS00003F78CE_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-212: Rno-mir-212 is a microRNA that was included in the primers provided by Tiangen Biotech [PMC5835133]. The primer sequences for rno-mir-212 amplification were 5′-TAA + CAGTCTCCAG-3′ (forward) and 5′-GTAAAACGACGGCCAGTCTACGCG-3′ (reverse) [PMC4171549]. In healthy Wistar islets, rno-mir-212 was one of the miRNAs that responded to glucose stimulation at both 8.3 mM and 16.7 mM concentrations [PMC3072418]. In the Wistar islets, there were three trends in miRNA expression changes upon stimulation at 16.7G compared to 2.8G: increasing levels for rno-miR-132, rno-mir-212, and rno-miR-409-3p; decreasing levels for rno-miR-124, rno-miR142-3p, rno-miR375, rno-miR335, rno-miR130a, and rno-miR708; and no significant change for rnomiR376a, rnomiR1425p, and rnomiR433 [PMC3072418]. The expression levels of miRNAs such as rnomiR130a,rnomi-R132,rnomir212,andrnomir335 changed within one hour of glucose stimulation [PMC3072418]. However,rnomir212andrnomi-R132 showed a decrease in miRNA levels upon stimulation at 16.7 G in contrast to the increasing trend observed in normal Wistar islets [PMC3072418]. In GK islets,rnomir132andrnomir212 showed decreased miRNA levels or no change, while rnomir409-3p showed no change, in response to increasing glucose concentrations [PMC3072418].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUUGGCUCUAGACUGCUUACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cervus elaphus cel-miR-212
  2. Gallus gallus Gallus_gallus piRNA piR-gga-80718
  3. Mus musculus Mus_musculus piRNA piR-mmu-7367660
  4. Ophiophagus hannah oha-miR-212-5p
Publications