Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-2392 URS00003F7488_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-2392: Hsa-mir-2392 is a microRNA that regulates multiple mRNAs, including CCND2, FAM241A, REL, POU2F1, and MICA [PMC7854084]. It has been proposed as a biomarker and therapeutic target for SARS-CoV-2 infection [PMC8686203]. The upregulation of hsa-mir-2392 has been observed in COVID-19 patients and is associated with poor outcomes [PMC9346380]. Hsa-mir-2392 is involved in downstream signaling pathways related to inflammation, glycolysis, and hypoxia [PMC9346380]. Hsa-mir-2392 is also targeted by hsa_circ_0006275 in MERS-CoV infection and regulates the expression of downstream targets such as MAP3K9, MYO15B, SPOCK1, MEF2C, USP15, and ZBTB11 [PMC9681929]. It has been studied in various animal models for SARS-CoV-2 infection to observe its conservation across species [PMC8481092].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGAUGGGGGUGAGAGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-2392
Publications