Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-199b-3p URS00003F2D94_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, PSICQUIC, LncBase, TarBase, RefSeq, GeneCards, MirGeneDB, MalaCards, miRBase). Described in 116 papers. Homo sapiens (human) hsa-miR-199b-3p sequence is a product of hsa-miR-199b, hsa-miR-199a, hsa-miR-199b-3p, miR-199b, MIR199B, MIR199A1, MIR199A2, miR-199b-3p, MIR199A2/214, miR-199a-3p, hsa-miR-199a-3p, miR-199, miR-199a genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3-zeta, 182-FIP, 20D7-FC4, 2C4D, 7h3, 80K-L, 82-FIP, A121, AASD-PPT, AASDHPPT.

Interactions 12

According to PSICQUIC, Homo sapiens (human) hsa-miR-199b-3p interacts with:

Interaction id Participant Synonyms
URS00003F2D94_9606-6 P08253 P08253
URS00003F2D94_9606-0 P08253 P08253
URS00003F2D94_9606-7 P14210 P14210
URS00003F2D94_9606-1 P14210 P14210
URS00003F2D94_9606-8 P17948 P17948
URS00003F2D94_9606-2 P17948 P17948
URS00003F2D94_9606-9 P35968 P35968
URS00003F2D94_9606-3 P35968 P35968
URS00003F2D94_9606-4 Q15389 Q15389
URS00003F2D94_9606-10 Q15389 Q15389
URS00003F2D94_9606-5 Q8WW22 Q8WW22
URS00003F2D94_9606-11 Q8WW22 Q8WW22

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACAGUAGUCUGCACAUUGGUUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 74 other species

    1. Alligator mississippiensis ami-miR-199-3p
    2. Anolis carolinensis Aca-Mir-199-P2-v1_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-199a-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-199-P2-v1_3p (mature (guide))
    5. Cavia porcellus cpo-miR-199-3p
    6. Chiloscyllium plagiosum microRNA cpl-miR-199a-3p
    7. Chrysemys picta bellii Cpi-Mir-199-P2-v1_3p (mature (guide))
    8. Chrysemys picta cpi-miR-199-3p
    9. Columba livia Cli-Mir-199-P3-v1_3p (mature (guide))
    10. Danio rerio Dre-Mir-199-P3-v1_3p (mature (guide))
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-199-3p
    12. Echinops telfairi Ete-Mir-199-P2-v1_3p (mature (guide))
    13. Equus caballus eca-miR-199a-3p
    14. Gadus morhua (Atlantic cod) gmo-miR-199-3p
    15. Gallus gallus (chicken) Gga-Mir-199-P3-v1_3p (mature (guide))
    16. Macaca fascicularis microRNA miR-199b-3p
    17. Macaca mulatta mml-miR-199a-3p
    18. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-199-P2-v1_3p (mature (guide))
    19. Mus musculus mmu-miR-199a-3p
    20. Ophiophagus hannah oha-miR-199a-3p
    21. Ornithorhynchus anatinus Oan-Mir-199-P3-v1_3p (mature (guide))
    22. Oryctolagus cuniculus ocu-miR-199a-3p
    23. Oryzias latipes ola-miR-199a-3p
    24. Pan troglodytes (chimpanzee) ptr-miR-199b
    25. Paralichthys olivaceus (Japanese flounder) pol-miR-199a-3p
    26. Rattus norvegicus rno-miR-199a-3p
    27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-199-P2-v1_3p (mature (guide))
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-199-P3-v1_3p (mature (guide))
    29. Sus scrofa ssc-miR-199a-3p
    30. Taeniopygia guttata (zebra finch) Tgu-Mir-199-P3-v1_3p (mature (guide))
    31. Xenopus tropicalis Xtr-Mir-199-P3-v1_3p (mature (guide))