Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-199a-3p URS00003F2D94_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (ENA, PirBase, PSICQUIC, LncBase, TarBase, RefSeq, MirGeneDB, miRBase). Described in 67 papers. Mus musculus (house mouse) mmu-miR-199a-3p sequence is a product of mmu-miR-199b, miR-199b, mmu-miR-199a, 199-a, mmu-miR-199b-3p, miR-199b-3p, Mir199a-1, Mir199a-2, miR-199a-3p, 199-as, mmu-miR-199a-3p, miR-199, miR-199a, Mir199b, miR-199-as genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1110062K04Rik, 5031434M05Rik, 5730552M22Rik, 8430420F16Rik, AIGP1, Aebp2, B230313N05Rik, Bnc2, CBF-A, Cgbfa.

Interactions 4

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-199a-3p interacts with:

Interaction id Participant Synonyms
URS00003F2D94_10090-0 Q8R1H0 Q8R1H0
URS00003F2D94_10090-2 Q8R1H0 Q8R1H0
URS00003F2D94_10090-1 Q9Z2Y3 Q9Z2Y3
URS00003F2D94_10090-3 Q9Z2Y3 Q9Z2Y3

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACAGUAGUCUGCACAUUGGUUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 74 other species

    1. Alligator mississippiensis ami-miR-199-3p
    2. Anolis carolinensis Aca-Mir-199-P2-v1_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-199a-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-199-P2-v1_3p (mature (guide))
    5. Cavia porcellus cpo-miR-199-3p
    6. Chiloscyllium plagiosum microRNA cpl-miR-199a-3p
    7. Chrysemys picta bellii Cpi-Mir-199-P2-v1_3p (mature (guide))
    8. Chrysemys picta cpi-miR-199-3p
    9. Columba livia Cli-Mir-199-P3-v1_3p (mature (guide))
    10. Danio rerio Dre-Mir-199-P3-v1_3p (mature (guide))
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-199-3p
    12. Echinops telfairi Ete-Mir-199-P2-v1_3p (mature (guide))
    13. Equus caballus eca-miR-199a-3p
    14. Gadus morhua (Atlantic cod) gmo-miR-199-3p
    15. Gallus gallus (chicken) Gga-Mir-199-P3-v1_3p (mature (guide))
    16. Homo sapiens (human) hsa-miR-199b-3p
    17. Macaca fascicularis microRNA miR-199b-3p
    18. Macaca mulatta mml-miR-199a-3p
    19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-199-P2-v1_3p (mature (guide))
    20. Ophiophagus hannah oha-miR-199a-3p
    21. Ornithorhynchus anatinus Oan-Mir-199-P3-v1_3p (mature (guide))
    22. Oryctolagus cuniculus ocu-miR-199a-3p
    23. Oryzias latipes ola-miR-199a-3p
    24. Pan troglodytes (chimpanzee) ptr-miR-199b
    25. Paralichthys olivaceus (Japanese flounder) pol-miR-199a-3p
    26. Rattus norvegicus rno-miR-199a-3p
    27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-199-P2-v1_3p (mature (guide))
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-199-P3-v1_3p (mature (guide))
    29. Sus scrofa ssc-miR-199a-3p
    30. Taeniopygia guttata (zebra finch) Tgu-Mir-199-P3-v1_3p (mature (guide))
    31. Xenopus tropicalis Xtr-Mir-199-P3-v1_3p (mature (guide))