Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-695 URS00003F2503_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-695: Mmu-mir-695 is a microRNA that exhibited the greatest decrease in expression in old mice [PMC3742134]. The expression of mmu-mir-695 was significantly downregulated in the corneal endothelium of old mice compared to young mice [PMC3742134]. Mmu-mir-695 was also one of the most significantly downregulated miRNAs in old mice [PMC3742134]. To validate these findings, qRT-PCR analysis was performed on mmu-mir-695 using the same extracted total RNA as the microarray analysis [PMC3742134].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUUGGGCAUAGGUGACUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications