Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-16-3p URS00003EDFF6_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-16: G Protein-Coupled Receptor Kinase 2 (Grk2) was identified as a potential target of rno-miR-15a and rno-mir-16, and downregulation of these miRNAs reduced thermal hyperalgesia and mechanical allodynia in rats with chronic constriction injury (CCI) [PMC8914318]. The expression of rno-miR-15a and rno-mir-16 was significantly increased in the spinal cord of CCI rats, suggesting their involvement in the development of neuropathic pain [PMC8914318]. Inhibition of rno-miR-15a and rno-mir-16 led to a remarkable increase in the expression of Grk2 in CCI rats [PMC8914318]. The miRNA transcripts observed in the blood and brain at 24 hours following reperfusion included rno-mir-16, -23a, -191, -292-5p, -320, -451, -494, and let-7. At 48 hours post-reperfusion, miRNAs such as miR-26a, -26b, -103, -107,-150,-185,-195,-191,-214,-320,-328,-352,-494,and let7 were observed [PMC4991681]. Rno-mir-16 was included as a control oligo for microarray analysis [PMC1790902]. Rno-mir-16 was reported to be involved in selenium deficiency-induced heart failure [PMC5920094]. In diabetic GK rats compared to Wistar and GK+Sita groups with lower expression levels of these microRNAs (rno-mir-16 included), several microRNAs were significantly upregulated [PMC5473486]. Rno-mir-16 was found to be common to both blood and brain at 24-hour reperfusion [PMC3606790]. Rno-mir-16 was identified as a putative binding site for miR-15b and miR-16 in the 3'UTR of Faim, suggesting Faim as a potential target for these miRNAs [PMC4508667]. Rno-mir-16 was among the muscle-specific circulating miRNAs associated with interstitial fibrosis, insulin resistance, and inflammation [PMC7667132]. Rno-mir-16 was exclusively expressed in the 24-hour samples [PMC8567963]. Several miRNAs, including rno-mir-16, were found to be associated with heart failure with preserved ejection fraction (HFpEF) development [PMC7667132].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAAUAUUAUUGUGCUGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications