Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-365 URS00003E7283_303518

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Pundamilia nyererei. Annotated by 1 database (miRBase). Found in the Pundamilia nyererei reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAUGCCCCUAAAAAUCCUUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 54 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-193-P2b_3p (mature (guide))
    2. Anolis carolinensis aca-miR-365-3p
    3. Bos taurus bta-miR-365-3p
    4. Callithrix jacchus cja-miR-365
    5. Callorhinchus milii (elephant shark) eshark_mir-365_1
    6. Canis lupus familiaris cfa-miR-365
    7. Capra hircus chi-miR-365-3p
    8. Cavia porcellus cpo-miR-365-3p
    9. Cervus elaphus cel-miR-365-3p
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-193-P2b_3p (mature (guide))
    11. Columba livia (rock pigeon) Cli-Mir-193-P2b_3p (mature (guide))
    12. Cricetulus griseus cgr-miR-365-3p
    13. Cyprinus carpio (common carp) ccr-miR-365
    14. Danio rerio (zebrafish) dre-miR-365
    15. Dasypus novemcinctus dno-miR-365-3p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-193-P2b_3p (mature (guide))
    17. Eptesicus fuscus efu-miR-365
    18. Equus caballus (horse) eca-miR-365
    19. Gadus morhua gmo-miR-365-3p
    20. Gallus gallus gga-miR-365-3p
    21. Gekko japonicus Gja-Mir-193-P2b_3p (mature (guide))
    22. Haplochromis burtoni abu-miR-365
    23. Homo sapiens hsa-miR-365b-3p
    24. Latimeria chalumnae Lch-Mir-193-P2b_3p (mature (guide))
    25. Lepisosteus oculatus (spotted gar) Loc-Mir-193-P2b_3p (mature (guide))
    26. Macaca mulatta mml-miR-365-3p
    27. Maylandia zebra (zebra mbuna) mze-miR-365
    28. Microcaecilia unicolor Mun-Mir-193-P2b_3p (mature (guide))
    29. Microcebus murinus mmr-miR-365
    30. Monodelphis domestica mdo-miR-365-3p
    31. Monopterus albus (swamp eel) Mal-Mir-193-P2b2_3p (mature (guide))
    32. Mus musculus mmu-miR-365-3p
    33. Neolamprologus brichardi nbr-miR-365
    34. Nomascus leucogenys nle-miR-365
    35. Ophiophagus hannah (king cobra) oha-miR-365a-3p
    36. Oreochromis niloticus (Nile tilapia) oni-miR-365
    37. Ornithorhynchus anatinus oan-miR-365-3p
    38. Oryctolagus cuniculus (rabbit) ocu-miR-365-3p
    39. Otolemur garnettii (small-eared galago) oga-miR-365
    40. Pan troglodytes (chimpanzee) ptr-miR-365
    41. Pongo pygmaeus ppy-miR-365
    42. Pteropus alecto pal-miR-365b-3p
    43. Python bivittatus Pbv-Mir-193-P2b_3p (mature (guide))
    44. Rattus norvegicus (Norway rat) rno-miR-365-3p
    45. Salmo salar (Atlantic salmon) ssa-miR-365-3p
    46. Sarcophilus harrisii Sha-Mir-193-P2b_3p (mature (guide))
    47. Sphenodon punctatus Spt-Mir-193-P2b_3p (mature (guide))
    48. Sus scrofa ssc-miR-365-3p
    49. Taeniopygia guttata tgu-miR-365-3p
    50. Takifugu rubripes (torafugu) fru-miR-365
    51. Tetraodon nigroviridis tni-miR-365
    52. Tor tambroides (Thai mahseer) miR-365
    53. Tupaia chinensis tch-miR-365b-3p
    54. Xenopus tropicalis (tropical clawed frog) xtr-miR-365