Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Maylandia zebra (zebra mbuna) mze-miR-365 URS00003E7283_106582

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Maylandia zebra. Annotated by 1 database (miRBase). Described in 0 papers. Found in the zebra mbuna reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUGCCCCUAAAAAUCCUUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 446 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-193-P2b_3p (mature (guide))
    2. Anolis carolinensis aca-miR-365-3p
    3. Bos taurus bta-miR-365-3p
    4. Callithrix jacchus cja-miR-365
    5. Callorhinchus milii eshark_mir-365_1
    6. Canis lupus familiaris cfa-miR-365
    7. Capra hircus (goat) chi-miR-365-3p
    8. Cavia porcellus cpo-miR-365-3p
    9. Cervus elaphus (red deer) cel-miR-365-3p
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-193-P2b_3p (mature (guide))
    11. Columba livia (rock pigeon) Cli-Mir-193-P2b_3p (mature (guide))
    12. Cricetulus griseus (Chinese hamster) cgr-miR-365-3p
    13. Cyprinus carpio ccr-miR-365
    14. Danio rerio (zebrafish) dre-miR-365
    15. Dasypus novemcinctus dno-miR-365-3p
    16. Echinops telfairi Ete-Mir-193-P2b_3p (mature (guide))
    17. Eptesicus fuscus efu-miR-365
    18. Equus caballus eca-miR-365
    19. Gadus morhua gmo-miR-365-3p
    20. Gallus gallus (chicken) gga-miR-365-3p
    21. Gekko japonicus Gja-Mir-193-P2b_3p (mature (guide))
    22. Haplochromis burtoni abu-miR-365
    23. Homo sapiens hsa-miR-365b-3p
    24. Latimeria chalumnae Lch-Mir-193-P2b_3p (mature (guide))
    25. Lepisosteus oculatus (spotted gar) Loc-Mir-193-P2b_3p (mature (guide))
    26. Macaca mulatta (Rhesus monkey) mml-miR-365-3p
    27. Microcaecilia unicolor Mun-Mir-193-P2b_3p (mature (guide))
    28. Microcebus murinus mmr-miR-365
    29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-365-3p
    30. Monopterus albus Mal-Mir-193-P2b2_3p (mature (guide))
    31. Mus musculus mmu-miR-365-3p
    32. Neolamprologus brichardi nbr-miR-365
    33. Nomascus leucogenys nle-miR-365
    34. Ophiophagus hannah (king cobra) oha-miR-365a-3p
    35. Oreochromis niloticus oni-miR-365
    36. Ornithorhynchus anatinus (platypus) oan-miR-365-3p
    37. Oryctolagus cuniculus ocu-miR-365-3p
    38. Otolemur garnettii oga-miR-365
    39. Pan troglodytes ptr-miR-365
    40. Pongo pygmaeus ppy-miR-365
    41. Pteropus alecto pal-miR-365b-3p
    42. Pundamilia nyererei pny-miR-365
    43. Python bivittatus (Burmese python) Pbv-Mir-193-P2b_3p (mature (guide))
    44. Rattus norvegicus (Norway rat) rno-miR-365-3p
    45. Salmo salar ssa-miR-365-3p
    46. Sarcophilus harrisii Sha-Mir-193-P2b_3p (mature (guide))
    47. Sphenodon punctatus (tuatara) Spt-Mir-193-P2b_3p (mature (guide))
    48. Sus scrofa (pig) ssc-miR-365-3p
    49. Taeniopygia guttata (zebra finch) tgu-miR-365-3p
    50. Takifugu rubripes (torafugu) fru-miR-365
    51. Tetraodon nigroviridis tni-miR-365
    52. Tor tambroides (Thai mahseer) miR-365
    53. Tupaia chinensis tch-miR-365b-3p
    54. Xenopus tropicalis xtr-miR-365