Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-365-3p URS00003E7283_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (ENA, RefSeq, MirGeneDB, PirBase, TarBase, miRBase). Mus musculus (house mouse) mmu-miR-365-3p sequence is a product of Mir365-1, miR-365, mmu-miR-365-3p, miR-365-3p, mmu-miR-365, Mir365-2 genes. Found in the Mus musculus reference genome. Interacts with protein-coding genes, including 0610007P14Rik, 0610008C09Rik, 0610010H08Rik, 0610010K06Rik, 0610013I17Rik, 0610031P22Rik, 0610035N01Rik, 0610037D15Rik, 0710001O03Rik, 0910001J09Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-365-3p interacts with:

Interaction id Participant Synonyms
URS00003E7283_10090-0 P08505 P08505
URS00003E7283_10090-1 P08505 P08505

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAUGCCCCUAAAAAUCCUUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 54 other species

    1. Alligator mississippiensis Ami-Mir-193-P2b_3p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-365-3p
    3. Bos taurus (cattle) bta-miR-365-3p
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-365
    5. Callorhinchus milii eshark_mir-365_1
    6. Canis lupus familiaris (dog) cfa-miR-365
    7. Capra hircus (goat) chi-miR-365-3p
    8. Cavia porcellus (domestic guinea pig) cpo-miR-365-3p
    9. Cervus elaphus cel-miR-365-3p
    10. Chrysemys picta bellii Cpi-Mir-193-P2b_3p (mature (guide))
    11. Columba livia (rock pigeon) Cli-Mir-193-P2b_3p (mature (guide))
    12. Cricetulus griseus (Chinese hamster) cgr-miR-365-3p
    13. Cyprinus carpio (common carp) ccr-miR-365
    14. Danio rerio dre-miR-365
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-365-3p
    16. Echinops telfairi Ete-Mir-193-P2b_3p (mature (guide))
    17. Eptesicus fuscus (big brown bat) efu-miR-365
    18. Equus caballus eca-miR-365
    19. Gadus morhua (Atlantic cod) gmo-miR-365-3p
    20. Gallus gallus gga-miR-365-3p
    21. Gekko japonicus Gja-Mir-193-P2b_3p (mature (guide))
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-365
    23. Homo sapiens hsa-miR-365b-3p
    24. Latimeria chalumnae (coelacanth) Lch-Mir-193-P2b_3p (mature (guide))
    25. Lepisosteus oculatus (spotted gar) Loc-Mir-193-P2b_3p (mature (guide))
    26. Macaca mulatta (Rhesus monkey) mml-miR-365-3p
    27. Maylandia zebra mze-miR-365
    28. Microcaecilia unicolor Mun-Mir-193-P2b_3p (mature (guide))
    29. Microcebus murinus mmr-miR-365
    30. Monodelphis domestica mdo-miR-365-3p
    31. Monopterus albus (swamp eel) Mal-Mir-193-P2b2_3p (mature (guide))
    32. Neolamprologus brichardi nbr-miR-365
    33. Nomascus leucogenys nle-miR-365
    34. Ophiophagus hannah (king cobra) oha-miR-365a-3p
    35. Oreochromis niloticus (Nile tilapia) oni-miR-365
    36. Ornithorhynchus anatinus oan-miR-365-3p
    37. Oryctolagus cuniculus ocu-miR-365-3p
    38. Otolemur garnettii (small-eared galago) oga-miR-365
    39. Pan troglodytes (chimpanzee) ptr-miR-365
    40. Pongo pygmaeus ppy-miR-365
    41. Pteropus alecto (black flying fox) pal-miR-365b-3p
    42. Pundamilia nyererei pny-miR-365
    43. Python bivittatus (Burmese python) Pbv-Mir-193-P2b_3p (mature (guide))
    44. Rattus norvegicus rno-miR-365-3p
    45. Salmo salar (Atlantic salmon) ssa-miR-365-3p
    46. Sarcophilus harrisii Sha-Mir-193-P2b_3p (mature (guide))
    47. Sphenodon punctatus (tuatara) Spt-Mir-193-P2b_3p (mature (guide))
    48. Sus scrofa (pig) ssc-miR-365-3p
    49. Taeniopygia guttata tgu-miR-365-3p
    50. Takifugu rubripes fru-miR-365
    51. Tetraodon nigroviridis tni-miR-365
    52. Tor tambroides (Thai mahseer) miR-365
    53. Tupaia chinensis (Chinese tree shrew) tch-miR-365a-3p
    54. Xenopus tropicalis (tropical clawed frog) xtr-miR-365
    Publications