Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-365-3p URS00003E7283_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, TarBase, PirBase, MirGeneDB, PSICQUIC, miRBase, ENA). Described in 25 papers. Mus musculus (house mouse) mmu-miR-365-3p sequence is a product of miR-365, mmu-miR-365-3p, Mir365-2, mmu-miR-365, miR-365-3p, Mir365-1 genes. Interacts with protein-coding genes, including 0610007P14Rik, 0610008C09Rik, 0610010H08Rik, 0610010K06Rik, 0610013I17Rik, 0610031P22Rik, 0610035N01Rik, 0610037D15Rik, 0710001O03Rik, 0910001J09Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-365-3p interacts with:

Interaction id Participant Synonyms
URS00003E7283_10090-0 P08505 P08505
URS00003E7283_10090-1 P08505 P08505

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUGCCCCUAAAAAUCCUUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 103 other species

    1. Alligator mississippiensis Ami-Mir-193-P2a_3p (mature (guide))
    2. Anolis carolinensis aca-miR-365-3p
    3. Bos taurus (cattle) bta-miR-365-3p
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-365
    5. Callorhinchus milii (elephant shark) eshark_mir-365_1
    6. Canis lupus familiaris (dog) cfa-miR-365
    7. Capra hircus chi-miR-365-3p
    8. Cavia porcellus cpo-miR-365-3p
    9. Cervus elaphus (red deer) cel-miR-365-3p
    10. Chrysemys picta bellii Cpi-Mir-193-P2a_3p (mature (guide))
    11. Columba livia Cli-Mir-193-P2a_3p (mature (guide))
    12. Cricetulus griseus (Chinese hamster) cgr-miR-365-3p
    13. Cyprinus carpio (common carp) ccr-miR-365
    14. Danio rerio dre-miR-365
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-365-3p
    16. Echinops telfairi Ete-Mir-193-P2a_3p (mature (guide))
    17. Eptesicus fuscus (big brown bat) efu-miR-365
    18. Equus caballus eca-miR-365
    19. Gadus morhua (Atlantic cod) gmo-miR-365-3p
    20. Gallus gallus (chicken) gga-miR-365-3p
    21. Haplochromis burtoni abu-miR-365
    22. Homo sapiens (human) hsa-miR-365b-3p
    23. Macaca mulatta mml-miR-365-3p
    24. Maylandia zebra (zebra mbuna) mze-miR-365
    25. Microcebus murinus (gray mouse lemur) mmr-miR-365
    26. Monodelphis domestica (gray short-tailed opossum) mdo-miR-365-3p
    27. Neolamprologus brichardi nbr-miR-365
    28. Nomascus leucogenys nle-miR-365
    29. Ophiophagus hannah oha-miR-365a-3p
    30. Oreochromis niloticus (Nile tilapia) oni-miR-365
    31. Ornithorhynchus anatinus oan-miR-365-3p
    32. Oryctolagus cuniculus ocu-miR-365-3p
    33. Otolemur garnettii oga-miR-365
    34. Pan troglodytes (chimpanzee) ptr-miR-365
    35. Pongo pygmaeus ppy-miR-365
    36. Pteropus alecto (black flying fox) pal-miR-365b-3p
    37. Pundamilia nyererei pny-miR-365
    38. Rattus norvegicus rno-miR-365-3p
    39. Salmo salar ssa-miR-365-3p
    40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P2a_3p (mature (guide))
    41. Sus scrofa ssc-miR-365-3p
    42. Taeniopygia guttata (zebra finch) tgu-miR-365-3p
    43. Takifugu rubripes fru-miR-365
    44. Tetraodon nigroviridis tni-miR-365
    45. Tor tambroides miR-365
    46. Tupaia chinensis (Chinese tree shrew) tch-miR-365b-3p
    47. Xenopus tropicalis xtr-miR-365