Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00003E7141_559292

Automated summary: This snoRNA sequence is 106 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (IntAct, ENA, RefSeq, SGD). Described in 31 papers. Matches 1 Rfam family (snR73, RF01207). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR73 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 3

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11710852 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-16640597 P38996 D6W3H8 EBI-11776 HMD1 NAB3 P38996 Q07034 YPL190C nab3_yeast
EBI-16640621 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUUUAUGAUGAUUUCCACAUUUCACGACGGUCAACUGCGUUUUUCGAAUGUUUAUCGAUUAACUUUGAUGAUAUUUCGCCUGUGACAGGGCGUGGUACUGAGCUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR73
    2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR73
    3. Saccharomyces cerevisiae YJM1083 SNR73
    4. Saccharomyces cerevisiae YJM1190 SNR73
    5. Saccharomyces cerevisiae YJM1199 SNR73
    6. Saccharomyces cerevisiae YJM1202 SNR73
    7. Saccharomyces cerevisiae YJM1208 SNR73
    8. Saccharomyces cerevisiae YJM1248 SNR73
    9. Saccharomyces cerevisiae YJM1273 SNR73
    10. Saccharomyces cerevisiae YJM1304 SNR73
    11. Saccharomyces cerevisiae YJM1311 SNR73
    12. Saccharomyces cerevisiae YJM1326 SNR73
    13. Saccharomyces cerevisiae YJM1338 SNR73
    14. Saccharomyces cerevisiae YJM1342 SNR73
    15. Saccharomyces cerevisiae YJM1381 SNR73
    16. Saccharomyces cerevisiae YJM1388 SNR73
    17. Saccharomyces cerevisiae YJM1389 SNR73
    18. Saccharomyces cerevisiae YJM1400 SNR73
    19. Saccharomyces cerevisiae YJM1402 SNR73
    20. Saccharomyces cerevisiae YJM1434 SNR73
    21. Saccharomyces cerevisiae YJM1439 SNR73
    22. Saccharomyces cerevisiae YJM1443 SNR73
    23. Saccharomyces cerevisiae YJM1444 SNR73
    24. Saccharomyces cerevisiae YJM1447 SNR73
    25. Saccharomyces cerevisiae YJM1460 SNR73
    26. Saccharomyces cerevisiae YJM1479 SNR73
    27. Saccharomyces cerevisiae YJM1549 SNR73
    28. Saccharomyces cerevisiae YJM1573 SNR73
    29. Saccharomyces cerevisiae YJM1592 SNR73
    30. Saccharomyces cerevisiae YJM1615 SNR73
    31. Saccharomyces cerevisiae YJM195 SNR73
    32. Saccharomyces cerevisiae YJM320 SNR73
    33. Saccharomyces cerevisiae YJM428 SNR73
    34. Saccharomyces cerevisiae YJM450 SNR73
    35. Saccharomyces cerevisiae YJM451 SNR73
    36. Saccharomyces cerevisiae YJM456 SNR73
    37. Saccharomyces cerevisiae YJM470 SNR73
    38. Saccharomyces cerevisiae YJM554 SNR73
    39. Saccharomyces cerevisiae YJM627 SNR73
    40. Saccharomyces cerevisiae YJM683 SNR73