Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-450a URS00003E5ECC_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-450a: Ssc-mir-450a is a microRNA that has been found to exhibit consistent up-regulation upon ZEN treatment in both the uterus and serum [PMC6598998]. It is one of several microRNAs that are up-regulated in both the uterus and serum after ZEN treatment, including ssc-miR-1, ssc-miR-542-3p, ssc-miR-143-5p, and others [PMC6598998]. Ssc-mir-450a is also differentially expressed in both the CK and TK groups [PMC9275911]. To validate the sequencing results, qRT-PCR was performed on five randomly selected differentially expressed miRNAs, including ssc-mir-450a [PMC5389138]. In a study on piglets exposed to contaminated feed, ssc-mir-450a was found to be one of several microRNAs commonly affected by ZEN exposure [PMC9142966]. It has also been shown that ZEN affects uterine expression of ssc-mir-450a in pigs [PMC6722729]. In a panel of microRNAs affected by ZEN exposure, ssc-mir-450a was found to be up-regulated along with other miRNAs such as ssc-miR-1 and ssc-miR503 [PMC6722729]. Overall, these findings highlight the role of ssc-mir-450a in response to ZEN exposure and its potential as a biomarker for evaluating the effects of mycotoxins on pig health.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUGCGAUGUGUUCCUAAUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-450a
  2. Callithrix jacchus cja-miR-450b
  3. Canis lupus familiaris Cfa-Mir-450-P1_5p (mature (guide))
  4. Cavia porcellus cpo-miR-450a-5p
  5. Cervus elaphus cel-miR-450
  6. Cricetulus griseus (Chinese hamster) cgr-miR-450a
  7. Dasypus novemcinctus dno-miR-450a-5p
  8. Eptesicus fuscus (big brown bat) efu-miR-450
  9. Equus caballus (horse) eca-miR-450a
  10. Homo sapiens hsa-miR-450a-5p
  11. Macaca mulatta mml-miR-450a-5p
  12. Mus musculus (house mouse) mmu-miR-450a-5p
  13. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-450a
  14. Oryctolagus cuniculus (rabbit) ocu-miR-450a-5p
  15. Pan paniscus ppa-miR-450a
  16. Pan troglodytes ptr-miR-450a
  17. Pteropus alecto (black flying fox) pal-miR-450a-5p
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-450a-5p
Publications