Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-450a-5p URS00003E5ECC_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUGCGAUGUGUUCCUAAUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-450a
  2. Callithrix jacchus cja-miR-450b
  3. Canis lupus familiaris Cfa-Mir-450-P1_5p (mature (guide))
  4. Cavia porcellus cpo-miR-450a-5p
  5. Cervus elaphus cel-miR-450
  6. Cricetulus griseus (Chinese hamster) cgr-miR-450a
  7. Dasypus novemcinctus dno-miR-450a-5p
  8. Eptesicus fuscus (big brown bat) efu-miR-450
  9. Equus caballus (horse) eca-miR-450a
  10. Homo sapiens hsa-miR-450a-5p
  11. Macaca mulatta mml-miR-450a-5p
  12. Mus musculus (house mouse) mmu-miR-450a-5p
  13. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-450a
  14. Oryctolagus cuniculus (rabbit) ocu-miR-450a-5p
  15. Pan paniscus ppa-miR-450a
  16. Pan troglodytes ptr-miR-450a
  17. Pteropus alecto (black flying fox) pal-miR-450a-5p
  18. Sus scrofa (pig) ssc-miR-450a
Publications